S4R441 · S4R441_HUMAN
- ProteinTransmembrane protein 80
- GeneTMEM80
- StatusUniProtKB unreviewed (TrEMBL)
- Organism
- Amino acids
- Protein existenceEvidence at protein level
- Annotation score1/5
Variants
Variant ID(s) | Position(s) | Change | Description | Clinical significance | Provenance | ||
---|---|---|---|---|---|---|---|
rs1033225975 | 2 | A>E | Variant of uncertain significance (Ensembl) | TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.97) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.695832C>A Codon: GCG/GAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695832C>A Locations: - p.Ala2Glu (Ensembl:ENST00000488769) - c.5C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861111791 | 2 | A>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.952) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.695831G>A Codon: GCG/ACG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695831G>A Locations: - p.Ala2Thr (Ensembl:ENST00000488769) - c.4G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1033225975 | 2 | A>V | Variant of uncertain significance (Ensembl) | TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.934) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.695832C>T Codon: GCG/GTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695832C>T Locations: - p.Ala2Val (Ensembl:ENST00000488769) - c.5C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs957782015 | 3 | A>P | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.211) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000011.10:g.695834G>C Codon: GCC/CCC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695834G>C Locations: - p.Ala3Pro (Ensembl:ENST00000488769) - c.7G>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs957782015 | 3 | A>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.054) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000011.10:g.695834G>A Codon: GCC/ACC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695834G>A Locations: - p.Ala3Thr (Ensembl:ENST00000488769) - c.7G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs576304398 | 3 | A>V | Variant of uncertain significance (Ensembl) | 1000Genomes TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.28) Somatic: No Accession: NC_000011.10:g.695835C>T Codon: GCC/GTC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695835C>T Locations: - p.Ala3Val (Ensembl:ENST00000488769) - c.8C>T (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1861113247 | 4 | P>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.88) Somatic: No Accession: NC_000011.10:g.695837C>G Codon: CCG/GCG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695837C>G Locations: - p.Pro4Ala (Ensembl:ENST00000488769) - c.10C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1355976716 | 4 | P>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.006) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000011.10:g.695838C>T Codon: CCG/CTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695838C>T Locations: - p.Pro4Leu (Ensembl:ENST00000488769) - c.11C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861113247 | 4 | P>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.38) Somatic: No Accession: NC_000011.10:g.695837C>T Codon: CCG/TCG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695837C>T Locations: - p.Pro4Ser (Ensembl:ENST00000488769) - c.10C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1433826300 | 5 | R>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.015) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.695841G>T Codon: CGG/CTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695841G>T Locations: - p.Arg5Leu (Ensembl:ENST00000488769) - c.14G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1007719586 | 5 | R>W | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.34) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.695840C>T Codon: CGG/TGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695840C>T Locations: - p.Arg5Trp (Ensembl:ENST00000488769) - c.13C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1590030077 | 6 | R>* | TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.695843C>T Codon: CGA/TGA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695843C>T Locations: - p.Arg6Ter (Ensembl:ENST00000488769) - c.16C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1308977347 | 6 | R>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000011.10:g.695844G>T Codon: CGA/CTA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695844G>T Locations: - p.Arg6Leu (Ensembl:ENST00000488769) - c.17G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1308977347 | 6 | R>P | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000011.10:g.695844G>C Codon: CGA/CCA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695844G>C Locations: - p.Arg6Pro (Ensembl:ENST00000488769) - c.17G>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1308977347 | 6 | R>Q | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.046) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000011.10:g.695844G>A Codon: CGA/CAA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695844G>A Locations: - p.Arg6Gln (Ensembl:ENST00000488769) - c.17G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1243669498 | 7 | G>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.695846G>A Codon: GGG/AGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.695846G>A Locations: - p.Gly7Arg (Ensembl:ENST00000488769) - c.19G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs751659452 | 8 | R>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.073) - SIFT: tolerated (0.15) Somatic: No Accession: NC_000011.10:g.698871A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698871A>G Locations: - p.Arg8Gly (Ensembl:ENST00000488769) - c.22A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs375077087 | 8 | R>K | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.34) Somatic: No Accession: NC_000011.10:g.698872G>A Codon: AGA/AAA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698872G>A Locations: - p.Arg8Lys (Ensembl:ENST00000488769) - c.23G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1246476552 | 9 | G>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.073) - SIFT: tolerated (0.27) Somatic: No Accession: NC_000011.10:g.698875G>A Codon: GGA/GAA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698875G>A Locations: - p.Gly9Glu (Ensembl:ENST00000488769) - c.26G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV58606715 rs768124828 | 9 | G>R | cosmic curated ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.115) - SIFT: tolerated (0.31) Somatic: Yes Accession: NC_000011.10:g.698874G>C Codon: GGA/CGA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698874G>C Locations: - p.Gly9Arg (Ensembl:ENST00000488769) - c.25G>C (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs866362023 | 10 | S>F | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.536) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000011.10:g.698878C>T Codon: TCC/TTC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698878C>T Locations: - p.Ser10Phe (Ensembl:ENST00000488769) - c.29C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs200935304 | 13 | V>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.15) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000011.10:g.698886G>T Codon: GTG/TTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.698886G>T Locations: - p.Val13Leu (Ensembl:ENST00000488769) - c.37G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1590036044 | 14 | L>V | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.994) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000011.10:g.700142C>G Codon: CTC/GTC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700142C>G Locations: - p.Leu14Val (Ensembl:ENST00000488769) - c.40C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1420536440 | 16 | S>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.700149C>A Codon: TCA/TAA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700149C>A Locations: - p.Ser16Ter (Ensembl:ENST00000488769) - c.47C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1413911055 | 17 | V>F | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.574) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700151G>T Codon: GTT/TTT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700151G>T Locations: - p.Val17Phe (Ensembl:ENST00000488769) - c.49G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1413911055 | 17 | V>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.011) - SIFT: tolerated (0.32) Somatic: No Accession: NC_000011.10:g.700151G>C Codon: GTT/CTT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700151G>C Locations: - p.Val17Leu (Ensembl:ENST00000488769) - c.49G>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861377007 | 18 | P>A | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.405) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000011.10:g.700154C>G Codon: CCC/GCC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700154C>G Locations: - p.Pro18Ala (Ensembl:ENST00000488769) - c.52C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861377230 | 18 | P>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.61) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000011.10:g.700155C>T Codon: CCC/CTC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700155C>T Locations: - p.Pro18Leu (Ensembl:ENST00000488769) - c.53C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs761193898 | 19 | L>F | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.700157C>T Codon: CTT/TTT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700157C>T Locations: - p.Leu19Phe (Ensembl:ENST00000488769) - c.55C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1206970499 | 22 | L>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.963) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700167T>C Codon: CTG/CCG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700167T>C Locations: - p.Leu22Pro (Ensembl:ENST00000488769) - c.65T>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs752884378 | 24 | Y>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000011.10:g.700173A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700173A>G Locations: - p.Tyr24Cys (Ensembl:ENST00000488769) - c.71A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs752884378 | 24 | Y>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.222) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.700173A>C Codon: TAT/TCT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700173A>C Locations: - p.Tyr24Ser (Ensembl:ENST00000488769) - c.71A>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861378538 | 26 | S>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.17) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000011.10:g.700178A>G Codon: AGC/GGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700178A>G Locations: - p.Ser26Gly (Ensembl:ENST00000488769) - c.76A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs141889473 | 26 | S>R | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.582) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000011.10:g.700180C>G Codon: AGC/AGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700180C>G Locations: - p.Ser26Arg (Ensembl:ENST00000488769) - c.78C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs143901821 | 27 | G>* | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.700181G>T Codon: GGA/TGA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700181G>T Locations: - p.Gly27Ter (Ensembl:ENST00000488769) - c.79G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV101217397 rs150628118 | 27 | G>E | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.166) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000011.10:g.700182G>A Codon: GGA/GAA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700182G>A Locations: - p.Gly27Glu (Ensembl:ENST00000488769) - c.80G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs143901821 | 27 | G>R | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.822) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000011.10:g.700181G>C, NC_000011.10:g.700181G>A Codon: GGA/CGA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700181G>C, NC_000011.10:g.700181G>A Locations: - p.Gly27Arg (Ensembl:ENST00000488769) - c.79G>C (Ensembl:ENST00000488769) - c.79G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs530418788 | 28 | T>M | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.006) - SIFT: tolerated (0.12) Somatic: No Accession: NC_000011.10:g.700185C>T Codon: ACG/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700185C>T Locations: - p.Thr28Met (Ensembl:ENST00000488769) - c.83C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs757190421 | 30 | Y>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.700192C>A Codon: TAC/TAA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700192C>A Locations: - p.Tyr30Ter (Ensembl:ENST00000488769) - c.90C>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs375402946 | 30 | Y>H | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.005) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.700190T>C Codon: TAC/CAC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700190T>C Locations: - p.Tyr30His (Ensembl:ENST00000488769) - c.88T>C (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs140467794 | 31 | A>T | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.035) - SIFT: tolerated (0.3) Somatic: No Accession: NC_000011.10:g.700193G>A Codon: GCC/ACC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700193G>A Locations: - p.Ala31Thr (Ensembl:ENST00000488769) - c.91G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1268082430 | 32 | L>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.756) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700197T>C Codon: CTG/CCG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700197T>C Locations: - p.Leu32Pro (Ensembl:ENST00000488769) - c.95T>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1445601951 | 33 | Y>C | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700200A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700200A>G Locations: - p.Tyr33Cys (Ensembl:ENST00000488769) - c.98A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861380615 | 34 | F>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.991) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700203T>G Codon: TTC/TGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700203T>G Locations: - p.Phe34Cys (Ensembl:ENST00000488769) - c.101T>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861380963 | 36 | A>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.913) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700209C>G Codon: GCC/GGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700209C>G Locations: - p.Ala36Gly (Ensembl:ENST00000488769) - c.107C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs769064980 | 36 | A>T | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.877) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000011.10:g.700208G>A Codon: GCC/ACC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700208G>A Locations: - p.Ala36Thr (Ensembl:ENST00000488769) - c.106G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1477854886 | 37 | T>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.024) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.700211A>G Codon: ACG/GCG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700211A>G Locations: - p.Thr37Ala (Ensembl:ENST00000488769) - c.109A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV66701099 rs536112009 | 37 | T>M | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.091) - SIFT: deleterious (0.02) Somatic: Yes Accession: NC_000011.10:g.700212C>T Codon: ACG/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700212C>T Locations: - p.Thr37Met (Ensembl:ENST00000488769) - c.110C>T (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs944374616 | 38 | L>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.216) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000011.10:g.700214C>A Codon: CTC/ATC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700214C>A Locations: - p.Leu38Ile (Ensembl:ENST00000488769) - c.112C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs2133462674 | 40 | M>V | Variant of uncertain significance (Ensembl) | Ensembl | |||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000011.10:g.700220A>G Codon: ATG/GTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700220A>G Locations: - p.Met40Val (Ensembl:ENST00000488769) - c.118A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs748320800 | 41 | I>M | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.034) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000011.10:g.700225C>G Codon: ATC/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700225C>G Locations: - p.Ile41Met (Ensembl:ENST00000488769) - c.123C>G (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1861381844 | 41 | I>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.129) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700224T>G Codon: ATC/AGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700224T>G Locations: - p.Ile41Ser (Ensembl:ENST00000488769) - c.122T>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs117149970 | 42 | T>K | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.071) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700227C>A Codon: ACG/AAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700227C>A Locations: - p.Thr42Lys (Ensembl:ENST00000488769) - c.125C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV107490345 rs117149970 | 42 | T>M | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.141) - SIFT: deleterious (0.03) Somatic: Yes Accession: NC_000011.10:g.700227C>T Codon: ACG/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700227C>T Locations: - p.Thr42Met (Ensembl:ENST00000488769) - c.125C>T (Ensembl:ENST00000488769) Source type: large scale study | |||||||
COSV68774021 rs1165617301 | 46 | Q>* | cosmic curated gnomAD | ||||
Consequence: missense Somatic: Yes Accession: NC_000011.10:g.700617C>T Codon: CAG/TAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700617C>T Locations: - p.Gln46Ter (Ensembl:ENST00000488769) - c.136C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1398068634 | 47 | V>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.061) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000011.10:g.700620G>T Codon: GTG/TTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700620G>T Locations: - p.Val47Leu (Ensembl:ENST00000488769) - c.139G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861408160 | 48 | F>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.153) - SIFT: tolerated (0.3) Somatic: No Accession: NC_000011.10:g.700625C>A Codon: TTC/TTA Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700625C>A Locations: - p.Phe48Leu (Ensembl:ENST00000488769) - c.144C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs781760079 | 49 | S>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.223) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700626A>G Codon: AGC/GGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700626A>G Locations: - p.Ser49Gly (Ensembl:ENST00000488769) - c.145A>G (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs937506529 | 49 | S>N | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.378) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700627G>A Codon: AGC/AAC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700627G>A Locations: - p.Ser49Asn (Ensembl:ENST00000488769) - c.146G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs781760079 | 49 | S>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.501) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700626A>C Codon: AGC/CGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700626A>C Locations: - p.Ser49Arg (Ensembl:ENST00000488769) - c.145A>C (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1205200574 | 50 | Y>H | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.968) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700629T>C Codon: TAT/CAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700629T>C Locations: - p.Tyr50His (Ensembl:ENST00000488769) - c.148T>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1205200574 | 50 | Y>N | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.917) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700629T>A Codon: TAT/AAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700629T>A Locations: - p.Tyr50Asn (Ensembl:ENST00000488769) - c.148T>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861408860 | 51 | P>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700633C>G Codon: CCT/CGT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700633C>G Locations: - p.Pro51Arg (Ensembl:ENST00000488769) - c.152C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs758602866 | 51 | P>S | Variant of uncertain significance (Ensembl) | ExAC gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700632C>T Codon: CCT/TCT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700632C>T Locations: - p.Pro51Ser (Ensembl:ENST00000488769) - c.151C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs778048624 | 52 | H>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.12) Somatic: No Accession: NC_000011.10:g.700636A>C Codon: CAC/CCC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700636A>C Locations: - p.His52Pro (Ensembl:ENST00000488769) - c.155A>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV68773756 rs200692386 | 52 | H>Y | cosmic curated 1000Genomes | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.12) Somatic: Yes Accession: NC_000011.10:g.700635C>T Codon: CAC/TAC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700635C>T Locations: - p.His52Tyr (Ensembl:ENST00000488769) - c.154C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV68774101 rs370532660 | 53 | R>C | Variant of uncertain significance (Ensembl) | cosmic curated ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.017) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000011.10:g.700638C>T Codon: CGC/TGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700638C>T Locations: - p.Arg53Cys (Ensembl:ENST00000488769) - c.157C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs370532660 | 53 | R>G | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.67) Somatic: No Accession: NC_000011.10:g.700638C>G Codon: CGC/GGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700638C>G Locations: - p.Arg53Gly (Ensembl:ENST00000488769) - c.157C>G (Ensembl:ENST00000488769) Source type: large scale study | |||||||
COSV68774010 rs547402747 | 53 | R>H | Likely benign (Ensembl) | cosmic curated 1000Genomes ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.12) Somatic: Yes Accession: NC_000011.10:g.700639G>A Codon: CGC/CAC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700639G>A Locations: - p.Arg53His (Ensembl:ENST00000488769) - c.158G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs547402747 | 53 | R>L | Likely benign (Ensembl) | 1000Genomes ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000011.10:g.700639G>T Codon: CGC/CTC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700639G>T Locations: - p.Arg53Leu (Ensembl:ENST00000488769) - c.158G>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs148483462 | 58 | D>H | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700653G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700653G>C Locations: - p.Asp58His (Ensembl:ENST00000488769) - c.172G>C (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs148483462 | 58 | D>N | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.985) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700653G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700653G>A Locations: - p.Asp58Asn (Ensembl:ENST00000488769) - c.172G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs768837423 | 59 | L>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.108) - SIFT: tolerated (0.18) Somatic: No Accession: NC_000011.10:g.700656C>G Codon: CTT/GTT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700656C>G Locations: - p.Leu59Val (Ensembl:ENST00000488769) - c.175C>G (Ensembl:ENST00000488769) Source type: large scale study | |||||||
COSV108245630 rs950147059 | 60 | A>T | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.005) - SIFT: tolerated (0.57) Somatic: Yes Accession: NC_000011.10:g.700659G>A Codon: GCT/ACT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700659G>A Locations: - p.Ala60Thr (Ensembl:ENST00000488769) - c.178G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1243567786 | 61 | L>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.905) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700663T>G Codon: CTG/CGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700663T>G Locations: - p.Leu61Arg (Ensembl:ENST00000488769) - c.182T>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861411059 | 62 | L>Q | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700666T>A Codon: CTG/CAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700666T>A Locations: - p.Leu62Gln (Ensembl:ENST00000488769) - c.185T>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1374466380 | 64 | L>V | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.169) - SIFT: tolerated (0.17) Somatic: No Accession: NC_000011.10:g.700671C>G Codon: CTG/GTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700671C>G Locations: - p.Leu64Val (Ensembl:ENST00000488769) - c.190C>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs760740395 | 65 | M>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.31) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000011.10:g.700676G>C Codon: ATG/ATC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700676G>C Locations: - p.Met65Ile (Ensembl:ENST00000488769) - c.195G>C (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs749921092 | 65 | M>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.044) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000011.10:g.700674A>T Codon: ATG/TTG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700674A>T Locations: - p.Met65Leu (Ensembl:ENST00000488769) - c.193A>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs2133465425 | 67 | I>M | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.635) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000011.10:g.700682T>G Codon: ATT/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700682T>G Locations: - p.Ile67Met (Ensembl:ENST00000488769) - c.201T>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1241892713 | 69 | E>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.951) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000011.10:g.700688A>T Codon: GAA/GAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700688A>T Locations: - p.Glu69Asp (Ensembl:ENST00000488769) - c.207A>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861412520 | 71 | V>D | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.105) - SIFT: deleterious (0) Somatic: No Accession: NC_000011.10:g.700693T>A Codon: GTT/GAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700693T>A Locations: - p.Val71Asp (Ensembl:ENST00000488769) - c.212T>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs142737710 | 71 | V>I | ESP gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.47) Somatic: No Accession: NC_000011.10:g.700692G>A Codon: GTT/ATT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700692G>A Locations: - p.Val71Ile (Ensembl:ENST00000488769) - c.211G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs142737710 | 71 | V>L | ESP gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000011.10:g.700692G>C Codon: GTT/CTT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700692G>C Locations: - p.Val71Leu (Ensembl:ENST00000488769) - c.211G>C (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs751842672 | 76 | G>D | ExAC | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000011.10:g.700708G>A Codon: GGT/GAT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700708G>A Locations: - p.Gly76Asp (Ensembl:ENST00000488769) - c.227G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1396430669 | 77 | E>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000011.10:g.700711A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700711A>G Locations: - p.Glu77Gly (Ensembl:ENST00000488769) - c.230A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs994797243 | 77 | E>K | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000011.10:g.700710G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700710G>A Locations: - p.Glu77Lys (Ensembl:ENST00000488769) - c.229G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1205535189 | 78 | W>* | TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.700715G>A Codon: TGG/TGA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700715G>A Locations: - p.Trp78Ter (Ensembl:ENST00000488769) - c.234G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs764468852 | 78 | W>V | ExAC | ||||
Consequence: stop gained Somatic: No Accession: NC_000011.10:g.700712_700713insGTTTCCACCCAATTCTAGATGTGTATTGAGGTATCTACACA Codon: -/GTTTCCACCCAATTCTAGATGTGTATTGAGGTATCTACACA Consequence type: stop gained Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700712_700713insGTTTCCACCCAATTCTAGATGTGTATTGAGGTATCTACACA Locations: - p.Trp78ValfsTer6 (Ensembl:ENST00000488769) - c.231_232insGTTTCCACCCAATTCTAGATGTGTATTGAGGTATCTACACA (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs199536012 | 79 | T>I | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0.04) Somatic: No Accession: NC_000011.10:g.700717C>T Codon: ACT/ATT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700717C>T Locations: - p.Thr79Ile (Ensembl:ENST00000488769) - c.236C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1861414912 | 80 | V>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.63) Somatic: No Accession: NC_000011.10:g.700719G>A Codon: GTT/ATT Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700719G>A Locations: - p.Val80Ile (Ensembl:ENST00000488769) - c.238G>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
COSV68773725 rs754819477 | 80 | R>Q | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.195) - SIFT: deleterious (0.03) Somatic: Yes Population frequencies: - MAF: 0.00001988 (gnomAD) Accession: NC_000011.10:g.700696G>A Codon: CGG/CAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700696G>A Locations: - p.R80Q (NCI-TCGA:ENST00000488769) - p.Arg72Gln (Ensembl:ENST00000488769) - c.215G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
COSV101284290 rs753750484 | 80 | R>W | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.976) - SIFT: deleterious (0) Somatic: Yes Population frequencies: - MAF: 0.00003181 (gnomAD) Accession: NC_000011.10:g.700695C>T Codon: CGG/TGG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700695C>T Locations: - p.R80W (NCI-TCGA:ENST00000488769) - p.Arg72Trp (Ensembl:ENST00000488769) - c.214C>T (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1263330195 | 82 | T>I | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.47) Somatic: No Accession: NC_000011.10:g.700726C>T Codon: ACC/ATC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700726C>T Locations: - p.Thr82Ile (Ensembl:ENST00000488769) - c.245C>T (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs1263330195 | 82 | T>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.1) Somatic: No Accession: NC_000011.10:g.700726C>A Codon: ACC/AAC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700726C>A Locations: - p.Thr82Asn (Ensembl:ENST00000488769) - c.245C>A (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs373357246 | 83 | V>M | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.08) Somatic: No Accession: NC_000011.10:g.700728G>A Codon: GTG/ATG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700728G>A Locations: - p.Val83Met (Ensembl:ENST00000488769) - c.247G>A (Ensembl:ENST00000488769) Source type: large scale study | |||||||
rs1426656190 | 84 | K>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated - low confidence (0.93) Somatic: No Accession: NC_000011.10:g.700731A>G Codon: AAG/GAG Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700731A>G Locations: - p.Lys84Glu (Ensembl:ENST00000488769) - c.250A>G (Ensembl:ENST00000488769) Source type: large scale study Cross-references: | |||||||
rs377327861 | 85 | N>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated - low confidence (0.1) Somatic: No Accession: NC_000011.10:g.700735A>G Codon: AAC/AGC Consequence type: missense Cytogenetic band: 11p15.5 Genomic location: NC_000011.10:g.700735A>G Locations: - p.Asn85Ser (Ensembl:ENST00000488769) - c.254A>G (Ensembl:ENST00000488769) Source type: large scale study |