O15318 · RPC7_HUMAN
- ProteinDNA-directed RNA polymerase III subunit RPC7
- GenePOLR3G
- StatusUniProtKB reviewed (Swiss-Prot)
- Organism
- Amino acids223 (go to sequence)
- Protein existenceEvidence at protein level
- Annotation score5/5
Variants
Variant ID(s) | Position(s) | Change | Description | Clinical significance | Provenance | ||
---|---|---|---|---|---|---|---|
rs181749699 | 2 | A>P | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.991) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485571G>C Codon: GCT/CCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485571G>C Locations: - p.Ala2Pro (Ensembl:ENST00000651687) - c.4G>C (Ensembl:ENST00000651687) - p.Ala2Pro (Ensembl:ENST00000504930) - c.4G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs181749699 | 2 | A>S | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.556) - SIFT: tolerated (0.07) Somatic: No Accession: NC_000005.10:g.90485571G>T Codon: GCT/TCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485571G>T Locations: - p.Ala2Ser (Ensembl:ENST00000651687) - c.4G>T (Ensembl:ENST00000651687) - p.Ala2Ser (Ensembl:ENST00000504930) - c.4G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs759375336 | 4 | N>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.989) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90485577A>C Codon: AAT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485577A>C Locations: - p.Asn4His (Ensembl:ENST00000651687) - c.10A>C (Ensembl:ENST00000651687) - p.Asn4His (Ensembl:ENST00000504930) - c.10A>C (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1751395351 | 4 | N>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.567) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90485578A>G Codon: AAT/AGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485578A>G Locations: - p.Asn4Ser (Ensembl:ENST00000504930) - c.11A>G (Ensembl:ENST00000504930) - p.Asn4Ser (Ensembl:ENST00000651687) - c.11A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1229901270 | 5 | K>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.904) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90485580A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485580A>G Locations: - p.Lys5Glu (Ensembl:ENST00000651687) - c.13A>G (Ensembl:ENST00000651687) - p.Lys5Glu (Ensembl:ENST00000504930) - c.13A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1283647636 | 6 | G>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90485584G>A Codon: GGA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485584G>A Locations: - p.Gly6Glu (Ensembl:ENST00000651687) - c.17G>A (Ensembl:ENST00000651687) - p.Gly6Glu (Ensembl:ENST00000504930) - c.17G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs769812298 | 7 | R>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.964) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90485586A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485586A>G Locations: - p.Arg7Gly (Ensembl:ENST00000651687) - c.19A>G (Ensembl:ENST00000651687) - p.Arg7Gly (Ensembl:ENST00000504930) - c.19A>G (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1217032955 | 8 | G>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485589G>A Codon: GGA/AGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485589G>A Locations: - p.Gly8Arg (Ensembl:ENST00000651687) - c.22G>A (Ensembl:ENST00000651687) - p.Gly8Arg (Ensembl:ENST00000504930) - c.22G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625313 rs373941949 | 9 | R>C | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | Variant of uncertain significance (Ensembl) | cosmic curated ESP ExAC TOPMed dbSNP gnomAD | ||
Consequence: missense Predictions: - PolyPhen: benign (0.386) - SIFT: tolerated (0.14) Somatic: Yes Population frequencies: - MAF: 0.00002008 (gnomAD) Accession: NC_000005.10:g.90485592C>T Codon: CGT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485592C>T Locations: - p.R9C (NCI-TCGA:ENST00000651687) - p.R9C (NCI-TCGA:ENST00000504930) - p.Arg9Cys (Ensembl:ENST00000504930) - c.25C>T (Ensembl:ENST00000504930) - p.Arg9Cys (Ensembl:ENST00000651687) - c.25C>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
COSV67625629 rs780251585 | 9 | R>H | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: tolerated (0.39) Somatic: Yes Population frequencies: - MAF: 0.00001605 (gnomAD) Accession: NC_000005.10:g.90485593G>A Codon: CGT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485593G>A Locations: - p.R9H (NCI-TCGA:ENST00000651687) - p.R9H (NCI-TCGA:ENST00000504930) - p.Arg9His (Ensembl:ENST00000504930) - c.26G>A (Ensembl:ENST00000504930) - p.Arg9His (Ensembl:ENST00000651687) - c.26G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
COSV67625480 rs866728572 | 11 | A>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated Ensembl dbSNP | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.887) - SIFT: deleterious (0.02) Somatic: Yes Accession: NC_000005.10:g.90485598G>A Codon: GCT/ACT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485598G>A Locations: - p.A11T (NCI-TCGA:ENST00000651687) - p.A11T (NCI-TCGA:ENST00000504930) - p.Ala11Thr (Ensembl:ENST00000504930) - c.31G>A (Ensembl:ENST00000504930) - p.Ala11Thr (Ensembl:ENST00000651687) - c.31G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1751396926 | 11 | A>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.967) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90485599C>T Codon: GCT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485599C>T Locations: - p.Ala11Val (Ensembl:ENST00000651687) - c.32C>T (Ensembl:ENST00000651687) - p.Ala11Val (Ensembl:ENST00000504930) - c.32C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs750587118 | 12 | Y>C | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.958) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485602A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485602A>G Locations: - p.Tyr12Cys (Ensembl:ENST00000651687) - c.35A>G (Ensembl:ENST00000651687) - p.Tyr12Cys (Ensembl:ENST00000504930) - c.35A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs752550237 | 13 | T>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.982) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485605C>T Codon: ACC/ATC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485605C>T Locations: - p.Thr13Ile (Ensembl:ENST00000504930) - c.38C>T (Ensembl:ENST00000504930) - p.Thr13Ile (Ensembl:ENST00000651687) - c.38C>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs376016457 | 14 | F>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485608T>C Codon: TTT/TCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485608T>C Locations: - p.Phe14Ser (Ensembl:ENST00000651687) - c.41T>C (Ensembl:ENST00000651687) - p.Phe14Ser (Ensembl:ENST00000504930) - c.41T>C (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs376016457 | 14 | F>Y | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.997) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485608T>A Codon: TTT/TAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485608T>A Locations: - p.Phe14Tyr (Ensembl:ENST00000651687) - c.41T>A (Ensembl:ENST00000651687) - p.Phe14Tyr (Ensembl:ENST00000504930) - c.41T>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1419531299 | 15 | N>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.929) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90485611A>G Codon: AAT/AGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485611A>G Locations: - p.Asn15Ser (Ensembl:ENST00000504930) - c.44A>G (Ensembl:ENST00000504930) - p.Asn15Ser (Ensembl:ENST00000651687) - c.44A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67626407 | 16 | I>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated | |||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485614T>C Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485614T>C Locations: - p.I16T (NCI-TCGA:ENST00000651687) - p.I16T (NCI-TCGA:ENST00000504930) - p.Ile16Thr (cosmic curated:ENST00000504930) - c.47T>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs754086629 | 16 | I>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.537) - SIFT: tolerated (0.2) Somatic: No Accession: NC_000005.10:g.90485613A>G Codon: ATT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485613A>G Locations: - p.Ile16Val (Ensembl:ENST00000504930) - c.46A>G (Ensembl:ENST00000504930) - p.Ile16Val (Ensembl:ENST00000651687) - c.46A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67625724 rs1387496544 | 17 | E>K | cosmic curated gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.918) - SIFT: deleterious (0) Somatic: Yes Accession: NC_000005.10:g.90485616G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485616G>A Locations: - p.Glu17Lys (Ensembl:ENST00000504930) - c.49G>A (Ensembl:ENST00000504930) - p.Glu17Lys (Ensembl:ENST00000651687) - c.49G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67625449 COSV67625449,COSV67625724 COSV67625724 rs1387496544 | 17 | E>Q | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.76) - SIFT: tolerated (0.06) Somatic: Yes Accession: NC_000005.10:g.90485616G>C Codon: GAG/CAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485616G>C Locations: - p.E17Q (NCI-TCGA:ENST00000651687) - p.E17Q (NCI-TCGA:ENST00000504930) - p.Glu17Gln (Ensembl:ENST00000651687) - c.49G>C (Ensembl:ENST00000651687) - p.Glu17Gln (Ensembl:ENST00000504930) - c.49G>C (Ensembl:ENST00000504930) Source type: large scale study | |||||||
COSV101209793 | 18 | A>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated | |||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485619G>A Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485619G>A Locations: - p.A18T (NCI-TCGA:ENST00000651687) - p.A18T (NCI-TCGA:ENST00000504930) - p.Ala18Thr (cosmic curated:ENST00000504930) - c.52G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV108248151 | 18 | A>V | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485620C>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90485620C>T Locations: - p.Ala18Val (cosmic curated:ENST00000504930) - c.53C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1580198213 | 19 | V>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.033) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90485623T>C Codon: GTT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485623T>C Locations: - p.Val19Ala (Ensembl:ENST00000651687) - c.56T>C (Ensembl:ENST00000651687) - p.Val19Ala (Ensembl:ENST00000504930) - c.56T>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1580198213 | 19 | V>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.398) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485623T>G Codon: GTT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485623T>G Locations: - p.Val19Gly (Ensembl:ENST00000651687) - c.56T>G (Ensembl:ENST00000651687) - p.Val19Gly (Ensembl:ENST00000504930) - c.56T>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751399735 | 20 | G>R | Variant of uncertain significance (Ensembl) | TOPMed | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.877) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485625G>C Codon: GGA/CGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485625G>C Locations: - p.Gly20Arg (Ensembl:ENST00000651687) - c.58G>C (Ensembl:ENST00000651687) - p.Gly20Arg (Ensembl:ENST00000504930) - c.58G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs2151902764 | 21 | F>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: tolerated (0.53) Somatic: No Accession: NC_000005.10:g.90485628T>A Codon: TTT/ATT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485628T>A Locations: - p.Phe21Ile (Ensembl:ENST00000651687) - c.61T>A (Ensembl:ENST00000651687) - p.Phe21Ile (Ensembl:ENST00000504930) - c.61T>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1251915435 | 21 | F>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: tolerated (0.19) Somatic: No Accession: NC_000005.10:g.90485630T>G Codon: TTT/TTG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485630T>G Locations: - p.Phe21Leu (Ensembl:ENST00000651687) - c.63T>G (Ensembl:ENST00000651687) - p.Phe21Leu (Ensembl:ENST00000504930) - c.63T>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209780 | 22 | S>N | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated | |||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485632G>A Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485632G>A Locations: - p.S22N (NCI-TCGA:ENST00000651687) - p.S22N (NCI-TCGA:ENST00000504930) - p.Ser22Asn (cosmic curated:ENST00000504930) - c.65G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751400164 | 23 | K>Q | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.661) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485634A>C Codon: AAA/CAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485634A>C Locations: - p.Lys23Gln (Ensembl:ENST00000651687) - c.67A>C (Ensembl:ENST00000651687) - p.Lys23Gln (Ensembl:ENST00000504930) - c.67A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1580198222 | 24 | G>V | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485638G>T Codon: GGT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485638G>T Locations: - p.Gly24Val (Ensembl:ENST00000651687) - c.71G>T (Ensembl:ENST00000651687) - p.Gly24Val (Ensembl:ENST00000504930) - c.71G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67626435 | 25 | E>K | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485640G>A Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90485640G>A Locations: - p.Glu25Lys (cosmic curated:ENST00000504930) - c.73G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs758971247 | 29 | D>E | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.437) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90485654T>G Codon: GAT/GAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485654T>G Locations: - p.Asp29Glu (Ensembl:ENST00000504930) - c.87T>G (Ensembl:ENST00000504930) - p.Asp29Glu (Ensembl:ENST00000651687) - c.87T>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1751401085 | 29 | D>N | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.978) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90485652G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485652G>A Locations: - p.Asp29Asn (Ensembl:ENST00000504930) - c.85G>A (Ensembl:ENST00000504930) - p.Asp29Asn (Ensembl:ENST00000651687) - c.85G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs930600374 | 30 | V>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.851) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000005.10:g.90485655G>A Codon: GTA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485655G>A Locations: - p.Val30Ile (Ensembl:ENST00000651687) - c.88G>A (Ensembl:ENST00000651687) - p.Val30Ile (Ensembl:ENST00000504930) - c.88G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625231 | 31 | V>L | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485658G>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90485658G>T Locations: - p.Val31Leu (cosmic curated:ENST00000504930) - c.91G>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1561248967 | 34 | P>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485668C>T Codon: CCA/CTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485668C>T Locations: - p.Pro34Leu (Ensembl:ENST00000651687) - c.101C>T (Ensembl:ENST00000651687) - p.Pro34Leu (Ensembl:ENST00000504930) - c.101C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs540238766 | 34 | P>S | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485667C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485667C>T Locations: - p.Pro34Ser (Ensembl:ENST00000504930) - c.100C>T (Ensembl:ENST00000504930) - p.Pro34Ser (Ensembl:ENST00000651687) - c.100C>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1443679124 | 35 | P>H | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.997) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90485671C>A Codon: CCC/CAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485671C>A Locations: - p.Pro35His (Ensembl:ENST00000504930) - c.104C>A (Ensembl:ENST00000504930) - p.Pro35His (Ensembl:ENST00000651687) - c.104C>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs745598020 | 35 | P>S | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.986) - SIFT: tolerated (0.63) Somatic: No Accession: NC_000005.10:g.90485670C>T Codon: CCC/TCC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485670C>T Locations: - p.Pro35Ser (Ensembl:ENST00000651687) - c.103C>T (Ensembl:ENST00000651687) - p.Pro35Ser (Ensembl:ENST00000504930) - c.103C>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs745598020 | 35 | P>T | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.986) - SIFT: tolerated (0.15) Somatic: No Accession: NC_000005.10:g.90485670C>A Codon: CCC/ACC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485670C>A Locations: - p.Pro35Thr (Ensembl:ENST00000651687) - c.103C>A (Ensembl:ENST00000651687) - p.Pro35Thr (Ensembl:ENST00000504930) - c.103C>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1561248987 | 36 | P>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.768) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90485673C>G Codon: CCA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485673C>G Locations: - p.Pro36Ala (Ensembl:ENST00000651687) - c.106C>G (Ensembl:ENST00000651687) - p.Pro36Ala (Ensembl:ENST00000504930) - c.106C>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625639 | 36 | P>S | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485673C>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90485673C>T Locations: - p.Pro36Ser (cosmic curated:ENST00000504930) - c.106C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751403143 | 37 | L>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.029) - SIFT: tolerated (0.18) Somatic: No Accession: NC_000005.10:g.90485677T>C Codon: CTA/CCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485677T>C Locations: - p.Leu37Pro (Ensembl:ENST00000504930) - c.110T>C (Ensembl:ENST00000504930) - p.Leu37Pro (Ensembl:ENST00000651687) - c.110T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67624916 | 38 | F>C | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90485680T>G Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90485680T>G Locations: - p.Phe38Cys (cosmic curated:ENST00000504930) - c.113T>G (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs200499655 | 39 | P>A | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485682C>G Codon: CCT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485682C>G Locations: - p.Pro39Ala (Ensembl:ENST00000504930) - c.115C>G (Ensembl:ENST00000504930) - p.Pro39Ala (Ensembl:ENST00000651687) - c.115C>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs202063059 | 39 | P>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485683C>T Codon: CCT/CTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485683C>T Locations: - p.Pro39Leu (Ensembl:ENST00000504930) - c.116C>T (Ensembl:ENST00000504930) - p.Pro39Leu (Ensembl:ENST00000651687) - c.116C>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs200499655 | 39 | P>S | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90485682C>T Codon: CCT/TCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90485682C>T Locations: - p.Pro39Ser (Ensembl:ENST00000504930) - c.115C>T (Ensembl:ENST00000504930) - p.Pro39Ser (Ensembl:ENST00000651687) - c.115C>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs774378694 | 40 | D>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.863) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000005.10:g.90488001A>G Codon: GAT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488001A>G Locations: - p.Asp40Gly (Ensembl:ENST00000504930) - c.119A>G (Ensembl:ENST00000504930) - p.Asp40Gly (Ensembl:ENST00000651687) - c.119A>G (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs768649611 | 40 | D>N | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.924) - SIFT: tolerated (0.67) Somatic: No Accession: NC_000005.10:g.90488000G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488000G>A Locations: - p.Asp40Asn (Ensembl:ENST00000504930) - c.118G>A (Ensembl:ENST00000504930) - p.Asp40Asn (Ensembl:ENST00000651687) - c.118G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs768649611 | 40 | D>Y | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.984) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90488000G>T Codon: GAT/TAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488000G>T Locations: - p.Asp40Tyr (Ensembl:ENST00000651687) - c.118G>T (Ensembl:ENST00000651687) - p.Asp40Tyr (Ensembl:ENST00000504930) - c.118G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs150301152 | 41 | T>I | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.341) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000005.10:g.90488004C>T Codon: ACA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488004C>T Locations: - p.Thr41Ile (Ensembl:ENST00000651687) - c.122C>T (Ensembl:ENST00000651687) - p.Thr41Ile (Ensembl:ENST00000504930) - c.122C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs150301152 | 41 | T>R | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.978) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488004C>G Codon: ACA/AGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488004C>G Locations: - p.Thr41Arg (Ensembl:ENST00000504930) - c.122C>G (Ensembl:ENST00000504930) - p.Thr41Arg (Ensembl:ENST00000651687) - c.122C>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1389730653 | 42 | D>V | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.985) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90488007A>T Codon: GAT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488007A>T Locations: - p.Asp42Val (Ensembl:ENST00000651687) - c.125A>T (Ensembl:ENST00000651687) - p.Asp42Val (Ensembl:ENST00000504930) - c.125A>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751534160 | 43 | Y>F | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.293) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90488010A>T Codon: TAT/TTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488010A>T Locations: - p.Tyr43Phe (Ensembl:ENST00000651687) - c.128A>T (Ensembl:ENST00000651687) - p.Tyr43Phe (Ensembl:ENST00000504930) - c.128A>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751534004 | 43 | Y>H | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.973) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90488009T>C Codon: TAT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488009T>C Locations: - p.Tyr43His (Ensembl:ENST00000504930) - c.127T>C (Ensembl:ENST00000504930) - p.Tyr43His (Ensembl:ENST00000651687) - c.127T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1326351126 | 45 | P>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.932) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488016C>T Codon: CCA/CTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488016C>T Locations: - p.Pro45Leu (Ensembl:ENST00000651687) - c.134C>T (Ensembl:ENST00000651687) - p.Pro45Leu (Ensembl:ENST00000504930) - c.134C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67626215 | 45 | P>S | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated | |||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90488015C>T Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488015C>T Locations: - p.P45S (NCI-TCGA:ENST00000651687) - p.P45S (NCI-TCGA:ENST00000504930) - p.Pro45Ser (cosmic curated:ENST00000504930) - c.133C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1191970657 | 46 | V>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.986) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488019T>A Codon: GTG/GAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488019T>A Locations: - p.Val46Glu (Ensembl:ENST00000504930) - c.137T>A (Ensembl:ENST00000504930) - p.Val46Glu (Ensembl:ENST00000651687) - c.137T>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs759740165 | 48 | L>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488025T>C Codon: CTG/CCG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488025T>C Locations: - p.Leu48Pro (Ensembl:ENST00000504930) - c.143T>C (Ensembl:ENST00000504930) - p.Leu48Pro (Ensembl:ENST00000651687) - c.143T>C (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs759740165 | 48 | L>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488025T>A Codon: CTG/CAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488025T>A Locations: - p.Leu48Gln (Ensembl:ENST00000504930) - c.143T>A (Ensembl:ENST00000504930) - p.Leu48Gln (Ensembl:ENST00000651687) - c.143T>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs765458616 | 49 | K>* | ExAC gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90488027A>T Codon: AAA/TAA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488027A>T Locations: - p.Lys49Ter (Ensembl:ENST00000504930) - c.145A>T (Ensembl:ENST00000504930) - p.Lys49Ter (Ensembl:ENST00000651687) - c.145A>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1253649317 | 49 | K>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.862) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90488028A>T Codon: AAA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488028A>T Locations: - p.Lys49Ile (Ensembl:ENST00000504930) - c.146A>T (Ensembl:ENST00000504930) - p.Lys49Ile (Ensembl:ENST00000651687) - c.146A>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1751535791 | 51 | G>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.986) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488034G>C Codon: GGA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488034G>C Locations: - p.Gly51Ala (Ensembl:ENST00000651687) - c.152G>C (Ensembl:ENST00000651687) - p.Gly51Ala (Ensembl:ENST00000504930) - c.152G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751535791 | 51 | G>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.985) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488034G>A Codon: GGA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488034G>A Locations: - p.Gly51Glu (Ensembl:ENST00000504930) - c.152G>A (Ensembl:ENST00000504930) - p.Gly51Glu (Ensembl:ENST00000651687) - c.152G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs372750594 | 52 | E>G | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.929) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488037A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488037A>G Locations: - p.Glu52Gly (Ensembl:ENST00000651687) - c.155A>G (Ensembl:ENST00000651687) - p.Glu52Gly (Ensembl:ENST00000504930) - c.155A>G (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs763336214 | 54 | E>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.881) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488043A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488043A>G Locations: - p.Glu54Gly (Ensembl:ENST00000504930) - c.161A>G (Ensembl:ENST00000504930) - p.Glu54Gly (Ensembl:ENST00000651687) - c.161A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV99065205 | 54 | E>K | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90488042G>A Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90488042G>A Locations: - p.Glu54Lys (cosmic curated:ENST00000504930) - c.160G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751536498 | 56 | Y>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488049A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488049A>G Locations: - p.Tyr56Cys (Ensembl:ENST00000651687) - c.167A>G (Ensembl:ENST00000651687) - p.Tyr56Cys (Ensembl:ENST00000504930) - c.167A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1191721477 | 59 | A>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488057G>C Codon: GCT/CCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488057G>C Locations: - p.Ala59Pro (Ensembl:ENST00000504930) - c.175G>C (Ensembl:ENST00000504930) - p.Ala59Pro (Ensembl:ENST00000651687) - c.175G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs764457356 | 59 | A>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488058C>T Codon: GCT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488058C>T Locations: - p.Ala59Val (Ensembl:ENST00000651687) - c.176C>T (Ensembl:ENST00000651687) - p.Ala59Val (Ensembl:ENST00000504930) - c.176C>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs946833803 | 62 | Q>H | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.997) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488068G>C Codon: CAG/CAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488068G>C Locations: - p.Gln62His (Ensembl:ENST00000504930) - c.186G>C (Ensembl:ENST00000504930) - p.Gln62His (Ensembl:ENST00000651687) - c.186G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1341920762 | 63 | E>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.948) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90488070A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488070A>G Locations: - p.Glu63Gly (Ensembl:ENST00000504930) - c.188A>G (Ensembl:ENST00000504930) - p.Glu63Gly (Ensembl:ENST00000651687) - c.188A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV104706897 rs1366712472 | 64 | L>* | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90488073T>A Codon: TTG/TAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488073T>A Locations: - p.Leu64Ter (Ensembl:ENST00000504930) - c.191T>A (Ensembl:ENST00000504930) - p.Leu64Ter (Ensembl:ENST00000651687) - c.191T>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
COSV67624843 rs376243020 | 64 | L>F | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated 1000Genomes ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.088) - SIFT: tolerated (0.12) Somatic: Yes Accession: NC_000005.10:g.90488074G>C, NC_000005.10:g.90488074G>T Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488074G>C, NC_000005.10:g.90488074G>T Locations: - p.L64F (NCI-TCGA:ENST00000651687) - p.L64F (NCI-TCGA:ENST00000504930) - p.Leu64Phe (cosmic curated:ENST00000504930) - c.192G>C (cosmic curated:ENST00000504930) - p.Leu64Phe (Ensembl:ENST00000651687) - c.192G>T (Ensembl:ENST00000651687) - p.Leu64Phe (Ensembl:ENST00000504930) - c.192G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1366712472 | 64 | L>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.912) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90488073T>C Codon: TTG/TCG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488073T>C Locations: - p.Leu64Ser (Ensembl:ENST00000504930) - c.191T>C (Ensembl:ENST00000504930) - p.Leu64Ser (Ensembl:ENST00000651687) - c.191T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs757746737 | 65 | R>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90488075A>T Codon: AGA/TGA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488075A>T Locations: - p.Arg65Ter (Ensembl:ENST00000651687) - c.193A>T (Ensembl:ENST00000651687) - p.Arg65Ter (Ensembl:ENST00000504930) - c.193A>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
COSV67625168 rs757746737 | 65 | R>G | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.314) - SIFT: deleterious (0.03) Somatic: Yes Accession: NC_000005.10:g.90488075A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488075A>G Locations: - p.Arg65Gly (Ensembl:ENST00000651687) - c.193A>G (Ensembl:ENST00000651687) - p.Arg65Gly (Ensembl:ENST00000504930) - c.193A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs200268836 | 66 | E>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.027) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90488079A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488079A>G Locations: - p.Glu66Gly (Ensembl:ENST00000651687) - c.197A>G (Ensembl:ENST00000651687) - p.Glu66Gly (Ensembl:ENST00000504930) - c.197A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs767052173 | 67 | T>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.426) - SIFT: tolerated (0.16) Somatic: No Accession: NC_000005.10:g.90488081A>G Codon: ACA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488081A>G Locations: - p.Thr67Ala (Ensembl:ENST00000651687) - c.199A>G (Ensembl:ENST00000651687) - p.Thr67Ala (Ensembl:ENST00000504930) - c.199A>G (Ensembl:ENST00000504930) Source type: large scale study | |||||||
COSV67624952 | 67 | T>K | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90488082C>A Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90488082C>A Locations: - p.Thr67Lys (cosmic curated:ENST00000504930) - c.200C>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs750015301 | 68 | M>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.067) - SIFT: tolerated (0.07) Somatic: No Accession: NC_000005.10:g.90488084A>G Codon: ATG/GTG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488084A>G Locations: - p.Met68Val (Ensembl:ENST00000504930) - c.202A>G (Ensembl:ENST00000504930) - p.Met68Val (Ensembl:ENST00000651687) - c.202A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs755774623 | 69 | K>E | ExAC | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.805) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90488087A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488087A>G Locations: - p.Lys69Glu (Ensembl:ENST00000651687) - c.205A>G (Ensembl:ENST00000651687) - p.Lys69Glu (Ensembl:ENST00000504930) - c.205A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751539496 | 70 | R>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.834) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90488091G>T Codon: AGA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488091G>T Locations: - p.Arg70Ile (Ensembl:ENST00000651687) - c.209G>T (Ensembl:ENST00000651687) - p.Arg70Ile (Ensembl:ENST00000504930) - c.209G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV108248153 rs1297240165 COSV67624807 | 71 | M>I | cosmic curated gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.151) - SIFT: deleterious (0.02) Somatic: Yes Accession: NC_000005.10:g.90488095G>A, NC_000005.10:g.90488095G>T Codon: ATG/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488095G>A, NC_000005.10:g.90488095G>T Locations: - p.Met71Ile (Ensembl:ENST00000651687) - c.213G>A (Ensembl:ENST00000651687) - p.Met71Ile (Ensembl:ENST00000504930) - c.213G>A (Ensembl:ENST00000504930) - p.Met71Ile (cosmic curated:ENST00000504930) - c.213G>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs779857623 | 75 | I>M | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.087) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000005.10:g.90488107T>G Codon: ATT/ATG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488107T>G Locations: - p.Ile75Met (Ensembl:ENST00000504930) - c.225T>G (Ensembl:ENST00000504930) - p.Ile75Met (Ensembl:ENST00000651687) - c.225T>G (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1383474999 | 75 | I>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.661) - SIFT: deleterious (0) Somatic: No Population frequencies: - MAF: 0.000004048 (gnomAD) Accession: NC_000005.10:g.90488106T>C Codon: ATT/ACT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488106T>C Locations: - p.I75T (NCI-TCGA:ENST00000651687) - p.I75T (NCI-TCGA:ENST00000504930) - p.Ile75Thr (Ensembl:ENST00000651687) - c.224T>C (Ensembl:ENST00000651687) - p.Ile75Thr (Ensembl:ENST00000504930) - c.224T>C (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1340722459 | 75 | I>V | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.049) - SIFT: tolerated (0.05) Somatic: No Accession: NC_000005.10:g.90488105A>G Codon: ATT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488105A>G Locations: - p.Ile75Val (Ensembl:ENST00000651687) - c.223A>G (Ensembl:ENST00000651687) - p.Ile75Val (Ensembl:ENST00000504930) - c.223A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1039745736 | 77 | T>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.04) - SIFT: tolerated (0.39) Somatic: No Accession: NC_000005.10:g.90488112C>T Codon: ACA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488112C>T Locations: - p.Thr77Ile (Ensembl:ENST00000651687) - c.230C>T (Ensembl:ENST00000651687) - p.Thr77Ile (Ensembl:ENST00000504930) - c.230C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs749052426 | 78 | P>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.303) - SIFT: tolerated (0.63) Somatic: No Accession: NC_000005.10:g.90488114C>G Codon: CCT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488114C>G Locations: - p.Pro78Ala (Ensembl:ENST00000651687) - c.232C>G (Ensembl:ENST00000651687) - p.Pro78Ala (Ensembl:ENST00000504930) - c.232C>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs754825782 | 79 | E>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.583) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000005.10:g.90488118A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488118A>G Locations: - p.Glu79Gly (Ensembl:ENST00000651687) - c.236A>G (Ensembl:ENST00000651687) - p.Glu79Gly (Ensembl:ENST00000504930) - c.236A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1032382555 | 79 | E>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.73) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000005.10:g.90488117G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488117G>A Locations: - p.Glu79Lys (Ensembl:ENST00000651687) - c.235G>A (Ensembl:ENST00000651687) - p.Glu79Lys (Ensembl:ENST00000504930) - c.235G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1285646631 | 80 | E>K | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.104) - SIFT: tolerated (0.49) Somatic: No Accession: NC_000005.10:g.90488120G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488120G>A Locations: - p.Glu80Lys (Ensembl:ENST00000651687) - c.238G>A (Ensembl:ENST00000651687) - p.Glu80Lys (Ensembl:ENST00000504930) - c.238G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1407973957 | 81 | R>G | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.134) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000005.10:g.90488123A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488123A>G Locations: - p.Arg81Gly (Ensembl:ENST00000651687) - c.241A>G (Ensembl:ENST00000651687) - p.Arg81Gly (Ensembl:ENST00000504930) - c.241A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1349612552 | 83 | D>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.009) - SIFT: tolerated (0.36) Somatic: No Accession: NC_000005.10:g.90495677A>G Codon: GAT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495677A>G Locations: - p.Asp83Gly (Ensembl:ENST00000651687) - c.248A>G (Ensembl:ENST00000651687) - p.Asp83Gly (Ensembl:ENST00000504930) - c.248A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1488735934 | 83 | D>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.561) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000005.10:g.90488129G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90488129G>A Locations: - p.Asp83Asn (Ensembl:ENST00000504930) - c.247G>A (Ensembl:ENST00000504930) - p.Asp83Asn (Ensembl:ENST00000651687) - c.247G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs768821152 | 84 | I>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.968) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90495680T>C Codon: ATT/ACT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495680T>C Locations: - p.Ile84Thr (Ensembl:ENST00000504930) - c.251T>C (Ensembl:ENST00000504930) - p.Ile84Thr (Ensembl:ENST00000651687) - c.251T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1751948182 | 86 | R>N | Ensembl | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90495685_90495686insACAACAGACAACATTTTTAATTTTACATACAG Codon: AGG/AACAACAGACAACATTTTTAATTTTACATACAGGG Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495685_90495686insACAACAGACAACATTTTTAATTTTACATACAG Locations: - p.Arg86AsnfsTer7 (Ensembl:ENST00000504930) - c.256_257insACAACAGACAACATTTTTAATTTTACATACAG (Ensembl:ENST00000504930) - p.Arg86AsnfsTer7 (Ensembl:ENST00000651687) - c.256_257insACAACAGACAACATTTTTAATTTTACATACAG (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1038954922 | 86 | R>T | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.567) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90495686G>C Codon: AGG/ACG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495686G>C Locations: - p.Arg86Thr (Ensembl:ENST00000651687) - c.257G>C (Ensembl:ENST00000651687) - p.Arg86Thr (Ensembl:ENST00000504930) - c.257G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs758637749 | 87 | Y>C | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90495689A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495689A>G Locations: - p.Tyr87Cys (Ensembl:ENST00000504930) - c.260A>G (Ensembl:ENST00000504930) - p.Tyr87Cys (Ensembl:ENST00000651687) - c.260A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67626177 | 88 | S>G | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90495691A>G Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90495691A>G Locations: - p.Ser88Gly (cosmic curated:ENST00000504930) - c.262A>G (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs762093499 | 88 | S>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000005.10:g.90495692G>T Codon: AGT/ATT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495692G>T Locations: - p.Ser88Ile (Ensembl:ENST00000504930) - c.263G>T (Ensembl:ENST00000504930) - p.Ser88Ile (Ensembl:ENST00000651687) - c.263G>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs762093499 | 88 | S>N | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90495692G>A Codon: AGT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495692G>A Locations: - p.Ser88Asn (Ensembl:ENST00000504930) - c.263G>A (Ensembl:ENST00000504930) - p.Ser88Asn (Ensembl:ENST00000651687) - c.263G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1270844626 | 90 | R>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.303) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90495697A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495697A>G Locations: - p.Arg90Gly (Ensembl:ENST00000651687) - c.268A>G (Ensembl:ENST00000651687) - p.Arg90Gly (Ensembl:ENST00000504930) - c.268A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625033 | 90 | R>I | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated | |||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90495698G>T Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495698G>T Locations: - p.R90I (NCI-TCGA:ENST00000651687) - p.R90I (NCI-TCGA:ENST00000504930) - p.Arg90Ile (cosmic curated:ENST00000504930) - c.269G>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs948522385 | 90 | R>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.015) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90495698G>A Codon: AGA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495698G>A Locations: - p.Arg90Lys (Ensembl:ENST00000504930) - c.269G>A (Ensembl:ENST00000504930) - p.Arg90Lys (Ensembl:ENST00000651687) - c.269G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV101209836 rs772592017 | 91 | Y>C | cosmic curated ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.241) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000005.10:g.90495701A>G Codon: TAC/TGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495701A>G Locations: - p.Tyr91Cys (Ensembl:ENST00000504930) - c.272A>G (Ensembl:ENST00000504930) - p.Tyr91Cys (Ensembl:ENST00000651687) - c.272A>G (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs773878464 | 92 | M>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.12) - SIFT: tolerated (0.27) Somatic: No Accession: NC_000005.10:g.90495703A>G Codon: ATG/GTG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495703A>G Locations: - p.Met92Val (Ensembl:ENST00000651687) - c.274A>G (Ensembl:ENST00000651687) - p.Met92Val (Ensembl:ENST00000504930) - c.274A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1288912703 | 93 | K>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.223) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000005.10:g.90495706A>G Codon: AAG/GAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495706A>G Locations: - p.Lys93Glu (Ensembl:ENST00000651687) - c.277A>G (Ensembl:ENST00000651687) - p.Lys93Glu (Ensembl:ENST00000504930) - c.277A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs761315363 | 94 | V>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: tolerated (0.4) Somatic: No Accession: NC_000005.10:g.90495709G>A Codon: GTA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495709G>A Locations: - p.Val94Ile (Ensembl:ENST00000651687) - c.280G>A (Ensembl:ENST00000651687) - p.Val94Ile (Ensembl:ENST00000504930) - c.280G>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs761315363 | 94 | V>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.06) - SIFT: tolerated (0.52) Somatic: No Accession: NC_000005.10:g.90495709G>C Codon: GTA/CTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495709G>C Locations: - p.Val94Leu (Ensembl:ENST00000651687) - c.280G>C (Ensembl:ENST00000651687) - p.Val94Leu (Ensembl:ENST00000504930) - c.280G>C (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs759168414 | 95 | Y>* | ExAC gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90495714C>A Codon: TAC/TAA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495714C>A Locations: - p.Tyr95Ter (Ensembl:ENST00000651687) - c.285C>A (Ensembl:ENST00000651687) - p.Tyr95Ter (Ensembl:ENST00000504930) - c.285C>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625798 rs753455193 | 95 | Y>C | cosmic curated ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.833) - SIFT: tolerated (0.18) Somatic: Yes Accession: NC_000005.10:g.90495713A>G Codon: TAC/TGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495713A>G Locations: - p.Tyr95Cys (Ensembl:ENST00000651687) - c.284A>G (Ensembl:ENST00000651687) - p.Tyr95Cys (Ensembl:ENST00000504930) - c.284A>G (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs752496323 | 96 | K>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.834) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000005.10:g.90495716A>G Codon: AAG/AGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495716A>G Locations: - p.Lys96Arg (Ensembl:ENST00000504930) - c.287A>G (Ensembl:ENST00000504930) - p.Lys96Arg (Ensembl:ENST00000651687) - c.287A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs758147049 | 98 | E>K | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.834) - SIFT: tolerated (0.05) Somatic: No Accession: NC_000005.10:g.90495721G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495721G>A Locations: - p.Glu98Lys (Ensembl:ENST00000504930) - c.292G>A (Ensembl:ENST00000504930) - p.Glu98Lys (Ensembl:ENST00000651687) - c.292G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs751465206 | 100 | I>K | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.065) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90495728T>A Codon: ATA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495728T>A Locations: - p.Ile100Lys (Ensembl:ENST00000651687) - c.299T>A (Ensembl:ENST00000651687) - p.Ile100Lys (Ensembl:ENST00000504930) - c.299T>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1751951463 | 100 | I>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.15) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90495727A>T Codon: ATA/TTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495727A>T Locations: - p.Ile100Leu (Ensembl:ENST00000504930) - c.298A>T (Ensembl:ENST00000504930) - p.Ile100Leu (Ensembl:ENST00000651687) - c.298A>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1180582646 | 102 | D>N | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.95) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90495733G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90495733G>A Locations: - p.Asp102Asn (Ensembl:ENST00000651687) - c.304G>A (Ensembl:ENST00000651687) - p.Asp102Asn (Ensembl:ENST00000504930) - c.304G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs751416316 | 102 | D>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.982) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90497656A>T Codon: GAT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497656A>T Locations: - p.Asp102Val (Ensembl:ENST00000504930) - c.305A>T (Ensembl:ENST00000504930) - p.Asp102Val (Ensembl:ENST00000651687) - c.305A>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs369143393 | 105 | R>I | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.382) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000005.10:g.90497665G>T Codon: AGA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497665G>T Locations: - p.Arg105Ile (Ensembl:ENST00000651687) - c.314G>T (Ensembl:ENST00000651687) - p.Arg105Ile (Ensembl:ENST00000504930) - c.314G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs767451320 | 106 | L>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.891) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90497667C>G Codon: CTT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497667C>G Locations: - p.Leu106Val (Ensembl:ENST00000651687) - c.316C>G (Ensembl:ENST00000651687) - p.Leu106Val (Ensembl:ENST00000504930) - c.316C>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625212 rs1336157157 | 107 | P>L | cosmic curated gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: Yes Accession: NC_000005.10:g.90497671C>T Codon: CCA/CTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497671C>T Locations: - p.Pro107Leu (Ensembl:ENST00000651687) - c.320C>T (Ensembl:ENST00000651687) - p.Pro107Leu (Ensembl:ENST00000504930) - c.320C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209826 rs753917944 | 107 | P>S | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated ExAC dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: Yes Population frequencies: - MAF: 0.00000415 (gnomAD) Accession: NC_000005.10:g.90497670C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497670C>T Locations: - p.P107S (NCI-TCGA:ENST00000651687) - p.P107S (NCI-TCGA:ENST00000504930) - p.Pro107Ser (Ensembl:ENST00000504930) - c.319C>T (Ensembl:ENST00000504930) - p.Pro107Ser (Ensembl:ENST00000651687) - c.319C>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs200084216 | 109 | E>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90497676G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497676G>A Locations: - p.Glu109Lys (Ensembl:ENST00000651687) - c.325G>A (Ensembl:ENST00000651687) - p.Glu109Lys (Ensembl:ENST00000504930) - c.325G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752056735 | 110 | M>I | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.398) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000005.10:g.90497681G>A Codon: ATG/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497681G>A Locations: - p.Met110Ile (Ensembl:ENST00000504930) - c.330G>A (Ensembl:ENST00000504930) - p.Met110Ile (Ensembl:ENST00000651687) - c.330G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1246326655 | 110 | M>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.848) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90497680T>A Codon: ATG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497680T>A Locations: - p.Met110Lys (Ensembl:ENST00000651687) - c.329T>A (Ensembl:ENST00000651687) - p.Met110Lys (Ensembl:ENST00000504930) - c.329T>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1246326655 | 110 | M>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.902) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90497680T>G Codon: ATG/AGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497680T>G Locations: - p.Met110Arg (Ensembl:ENST00000651687) - c.329T>G (Ensembl:ENST00000651687) - p.Met110Arg (Ensembl:ENST00000504930) - c.329T>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs371785299 | 112 | P>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.929) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000005.10:g.90497685C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497685C>T Locations: - p.Pro112Ser (Ensembl:ENST00000651687) - c.334C>T (Ensembl:ENST00000651687) - p.Pro112Ser (Ensembl:ENST00000504930) - c.334C>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs549458634 | 113 | R>I | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.661) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90497689G>T Codon: AGA/ATA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497689G>T Locations: - p.Arg113Ile (Ensembl:ENST00000504930) - c.338G>T (Ensembl:ENST00000504930) - p.Arg113Ile (Ensembl:ENST00000651687) - c.338G>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
COSV105333319 rs549458634 | 113 | R>T | cosmic curated 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.067) - SIFT: tolerated (0.05) Somatic: Yes Accession: NC_000005.10:g.90497689G>C Codon: AGA/ACA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497689G>C Locations: - p.Arg113Thr (Ensembl:ENST00000504930) - c.338G>C (Ensembl:ENST00000504930) - p.Arg113Thr (Ensembl:ENST00000651687) - c.338G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752057287 | 116 | C>R | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.249) - SIFT: tolerated (0.42) Somatic: No Accession: NC_000005.10:g.90497697T>C Codon: TGT/CGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90497697T>C Locations: - p.Cys116Arg (Ensembl:ENST00000504930) - c.346T>C (Ensembl:ENST00000504930) - p.Cys116Arg (Ensembl:ENST00000651687) - c.346T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1372656355 | 120 | G>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.078) - SIFT: tolerated (0.17) Somatic: No Accession: NC_000005.10:g.90501909G>A Codon: GGC/GAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501909G>A Locations: - p.Gly120Asp (Ensembl:ENST00000651687) - c.359G>A (Ensembl:ENST00000651687) - p.Gly120Asp (Ensembl:ENST00000504930) - c.359G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209821 | 123 | P>L | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90501918C>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90501918C>T Locations: - p.Pro123Leu (cosmic curated:ENST00000504930) - c.368C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs757532254 | 123 | P>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.006) - SIFT: tolerated (0.19) Somatic: No Accession: NC_000005.10:g.90501918C>G Codon: CCA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501918C>G Locations: - p.Pro123Arg (Ensembl:ENST00000651687) - c.368C>G (Ensembl:ENST00000651687) - p.Pro123Arg (Ensembl:ENST00000504930) - c.368C>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67626202 | 125 | K>E | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90501923A>G Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90501923A>G Locations: - p.Lys125Glu (cosmic curated:ENST00000504930) - c.373A>G (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752262386 | 125 | K>T | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.011) - SIFT: tolerated (0.16) Somatic: No Accession: NC_000005.10:g.90501924A>C Codon: AAG/ACG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501924A>C Locations: - p.Lys125Thr (Ensembl:ENST00000651687) - c.374A>C (Ensembl:ENST00000651687) - p.Lys125Thr (Ensembl:ENST00000504930) - c.374A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs973470702 | 126 | A>E | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.08) - SIFT: tolerated (0.29) Somatic: No Accession: NC_000005.10:g.90501927C>A Codon: GCA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501927C>A Locations: - p.Ala126Glu (Ensembl:ENST00000651687) - c.377C>A (Ensembl:ENST00000651687) - p.Ala126Glu (Ensembl:ENST00000504930) - c.377C>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs756120245 | 126 | A>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.087) - SIFT: tolerated (0.25) Somatic: No Accession: NC_000005.10:g.90501926G>T Codon: GCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501926G>T Locations: - p.Ala126Ser (Ensembl:ENST00000651687) - c.376G>T (Ensembl:ENST00000651687) - p.Ala126Ser (Ensembl:ENST00000504930) - c.376G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1283399074 | 127 | K>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.73) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000005.10:g.90501929A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501929A>G Locations: - p.Lys127Glu (Ensembl:ENST00000504930) - c.379A>G (Ensembl:ENST00000504930) - p.Lys127Glu (Ensembl:ENST00000651687) - c.379A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs765230301 | 128 | D>H | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.788) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000005.10:g.90501932G>C Codon: GAC/CAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501932G>C Locations: - p.Asp128His (Ensembl:ENST00000504930) - c.382G>C (Ensembl:ENST00000504930) - p.Asp128His (Ensembl:ENST00000651687) - c.382G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs765230301 | 128 | D>N | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.255) - SIFT: tolerated (0.48) Somatic: No Accession: NC_000005.10:g.90501932G>A Codon: GAC/AAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501932G>A Locations: - p.Asp128Asn (Ensembl:ENST00000651687) - c.382G>A (Ensembl:ENST00000651687) - p.Asp128Asn (Ensembl:ENST00000504930) - c.382G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1439754505 | 128 | D>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: tolerated (0.32) Somatic: No Accession: NC_000005.10:g.90501933A>T Codon: ACG/TCG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501933A>T Locations: - p.Asp128Val (Ensembl:ENST00000651687) - c.383A>T (Ensembl:ENST00000651687) - p.Asp128Val (Ensembl:ENST00000504930) - c.383A>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67626382 rs200186119 | 129 | A>T | Likely benign (Ensembl) | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.015) - SIFT: tolerated (0.63) Somatic: Yes Accession: NC_000005.10:g.90501935G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501935G>A Locations: - p.Ala129Thr (Ensembl:ENST00000651687) - c.385G>A (Ensembl:ENST00000651687) - p.Ala129Thr (Ensembl:ENST00000504930) - c.385G>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs948228132 | 129 | A>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.303) - SIFT: tolerated (0.2) Somatic: No Accession: NC_000005.10:g.90501936C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501936C>T Locations: - p.Ala129Val (Ensembl:ENST00000504930) - c.386C>T (Ensembl:ENST00000504930) - p.Ala129Val (Ensembl:ENST00000651687) - c.386C>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1418714751 | 130 | G>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.059) - SIFT: tolerated (0.92) Somatic: No Accession: NC_000005.10:g.90501938G>A Codon: GGC/AGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501938G>A Locations: - p.Gly130Ser (Ensembl:ENST00000651687) - c.388G>A (Ensembl:ENST00000651687) - p.Gly130Ser (Ensembl:ENST00000504930) - c.388G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752264445 | 130 | G>V | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.398) - SIFT: tolerated (0.31) Somatic: No Accession: NC_000005.10:g.90501939G>T Codon: GGC/GTC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501939G>T Locations: - p.Gly130Val (Ensembl:ENST00000651687) - c.389G>T (Ensembl:ENST00000651687) - p.Gly130Val (Ensembl:ENST00000504930) - c.389G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs751920496 | 131 | K>E | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.049) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000005.10:g.90501941A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501941A>G Locations: - p.Lys131Glu (Ensembl:ENST00000504930) - c.391A>G (Ensembl:ENST00000504930) - p.Lys131Glu (Ensembl:ENST00000651687) - c.391A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752264721 | 132 | G>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.723) - SIFT: tolerated (0.77) Somatic: No Accession: NC_000005.10:g.90501944G>A Codon: GGC/AGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501944G>A Locations: - p.Gly132Ser (Ensembl:ENST00000651687) - c.394G>A (Ensembl:ENST00000651687) - p.Gly132Ser (Ensembl:ENST00000504930) - c.394G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1580215241 | 132 | G>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.118) - SIFT: tolerated (0.32) Somatic: No Accession: NC_000005.10:g.90501945G>T Codon: GGC/GTC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501945G>T Locations: - p.Gly132Val (Ensembl:ENST00000504930) - c.395G>T (Ensembl:ENST00000504930) - p.Gly132Val (Ensembl:ENST00000651687) - c.395G>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs2151912271 | 134 | P>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90501950C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501950C>T Locations: - p.Pro134Ser (Ensembl:ENST00000504930) - c.400C>T (Ensembl:ENST00000504930) - p.Pro134Ser (Ensembl:ENST00000651687) - c.400C>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV101209867 rs1752265468 | 136 | T>A | cosmic curated Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated (0.5) Somatic: Yes Accession: NC_000005.10:g.90501956A>G Codon: ACT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501956A>G Locations: - p.Thr136Ala (Ensembl:ENST00000651687) - c.406A>G (Ensembl:ENST00000651687) - p.Thr136Ala (Ensembl:ENST00000504930) - c.406A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752265679 | 137 | N>D | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.006) - SIFT: tolerated (0.56) Somatic: No Accession: NC_000005.10:g.90501959A>G Codon: AAT/GAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501959A>G Locations: - p.Asn137Asp (Ensembl:ENST00000651687) - c.409A>G (Ensembl:ENST00000651687) - p.Asn137Asp (Ensembl:ENST00000504930) - c.409A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209764 rs998665890 rs998665890,COSV101209764 | 138 | T>A | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.303) - SIFT: tolerated (0.52) Somatic: Yes Accession: NC_000005.10:g.90501962A>G Codon: ATA/ATG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501962A>G Locations: - p.T138A (NCI-TCGA:ENST00000651687) - p.T138A (NCI-TCGA:ENST00000504930) - p.Thr138Ala (Ensembl:ENST00000504930) - c.412A>G (Ensembl:ENST00000504930) - p.Thr138Ala (Ensembl:ENST00000651687) - c.412A>G (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1372502061 | 140 | D>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90501969A>G Codon: GAT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501969A>G Locations: - p.Asp140Gly (Ensembl:ENST00000504930) - c.419A>G (Ensembl:ENST00000504930) - p.Asp140Gly (Ensembl:ENST00000651687) - c.419A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1191584331 | 140 | D>Y | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90501968G>T Codon: GAT/TAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501968G>T Locations: - p.Asp140Tyr (Ensembl:ENST00000504930) - c.418G>T (Ensembl:ENST00000504930) - p.Asp140Tyr (Ensembl:ENST00000651687) - c.418G>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1462378261 | 141 | V>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.639) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90501972T>C Codon: TGT/CGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501972T>C Locations: - p.Val141Ala (Ensembl:ENST00000651687) - c.422T>C (Ensembl:ENST00000651687) - p.Val141Ala (Ensembl:ENST00000504930) - c.422T>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs2151912287 | 143 | K>E | 1000Genomes | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000005.10:g.90501977A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501977A>G Locations: - p.Lys143Glu (Ensembl:ENST00000504930) - c.427A>G (Ensembl:ENST00000504930) - p.Lys143Glu (Ensembl:ENST00000651687) - c.427A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1388254715 | 143 | K>N | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: tolerated (0.27) Somatic: No Accession: NC_000005.10:g.90501979A>C Codon: AAA/AAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501979A>C Locations: - p.Lys143Asn (Ensembl:ENST00000651687) - c.429A>C (Ensembl:ENST00000651687) - p.Lys143Asn (Ensembl:ENST00000504930) - c.429A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1472019911 | 143 | K>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90501978A>G Codon: AAA/AGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501978A>G Locations: - p.Lys143Arg (Ensembl:ENST00000504930) - c.428A>G (Ensembl:ENST00000504930) - p.Lys143Arg (Ensembl:ENST00000651687) - c.428A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67625856 | 145 | M>I | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90501985G>A Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90501985G>A Locations: - p.Met145Ile (cosmic curated:ENST00000504930) - c.435G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1303430192 | 146 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90501987A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501987A>G Locations: - p.Glu146Gly (Ensembl:ENST00000651687) - c.437A>G (Ensembl:ENST00000651687) - p.Glu146Gly (Ensembl:ENST00000504930) - c.437A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752267250 | 146 | E>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90501986G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90501986G>A Locations: - p.Glu146Lys (Ensembl:ENST00000504930) - c.436G>A (Ensembl:ENST00000504930) - p.Glu146Lys (Ensembl:ENST00000651687) - c.436G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67625682 | 146 | E>Q | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90501986G>C Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90501986G>C Locations: - p.Glu146Gln (cosmic curated:ENST00000504930) - c.436G>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs757619271 | 147 | E>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90506528G>T Codon: GAA/TAA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506528G>T Locations: - p.Glu147Ter (Ensembl:ENST00000504930) - c.439G>T (Ensembl:ENST00000504930) - p.Glu147Ter (Ensembl:ENST00000651687) - c.439G>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1216746522 | 149 | E>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.802) - SIFT: tolerated (0.28) Somatic: No Accession: NC_000005.10:g.90506535A>C Codon: GAA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506535A>C Locations: - p.Glu149Ala (Ensembl:ENST00000651687) - c.446A>C (Ensembl:ENST00000651687) - p.Glu149Ala (Ensembl:ENST00000504930) - c.446A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1176565488 | 150 | K>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.198) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90506537A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506537A>G Locations: - p.Lys150Glu (Ensembl:ENST00000504930) - c.448A>G (Ensembl:ENST00000504930) - p.Lys150Glu (Ensembl:ENST00000651687) - c.448A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1257301922 | 152 | G>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000005.10:g.90506543G>T Codon: GGT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506543G>T Locations: - p.Gly152Cys (Ensembl:ENST00000504930) - c.454G>T (Ensembl:ENST00000504930) - p.Gly152Cys (Ensembl:ENST00000651687) - c.454G>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV105333324 rs1752493236 | 152 | G>D | cosmic curated TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: tolerated (0.67) Somatic: Yes Accession: NC_000005.10:g.90506544G>A Codon: GGT/GAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506544G>A Locations: - p.Gly152Asp (Ensembl:ENST00000651687) - c.455G>A (Ensembl:ENST00000651687) - p.Gly152Asp (Ensembl:ENST00000504930) - c.455G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1257301922 | 152 | G>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90506543G>A Codon: GGT/AGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506543G>A Locations: - p.Gly152Ser (Ensembl:ENST00000651687) - c.454G>A (Ensembl:ENST00000651687) - p.Gly152Ser (Ensembl:ENST00000504930) - c.454G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1386807939 | 153 | D>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90506547A>C Codon: GAT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506547A>C Locations: - p.Asp153Ala (Ensembl:ENST00000504930) - c.458A>C (Ensembl:ENST00000504930) - p.Asp153Ala (Ensembl:ENST00000651687) - c.458A>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs978361823 | 153 | D>E | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000005.10:g.90506548T>A Codon: GAT/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506548T>A Locations: - p.Asp153Glu (Ensembl:ENST00000504930) - c.459T>A (Ensembl:ENST00000504930) - p.Asp153Glu (Ensembl:ENST00000651687) - c.459T>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1183982766 | 153 | D>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000005.10:g.90506546G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506546G>A Locations: - p.Asp153Asn (Ensembl:ENST00000504930) - c.457G>A (Ensembl:ENST00000504930) - p.Asp153Asn (Ensembl:ENST00000651687) - c.457G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs925126840 | 154 | G>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90506549G>T Codon: GGT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506549G>T Locations: - p.Gly154Cys (Ensembl:ENST00000651687) - c.460G>T (Ensembl:ENST00000651687) - p.Gly154Cys (Ensembl:ENST00000504930) - c.460G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1437468063 | 155 | E>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90506552G>T Codon: GAA/TAA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506552G>T Locations: - p.Glu155Ter (Ensembl:ENST00000651687) - c.463G>T (Ensembl:ENST00000651687) - p.Glu155Ter (Ensembl:ENST00000504930) - c.463G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209784 | 155 | E>A | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506553A>C Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506553A>C Locations: - p.Glu155Ala (cosmic curated:ENST00000504930) - c.464A>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1157972051 | 155 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90506553A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506553A>G Locations: - p.Glu155Gly (Ensembl:ENST00000651687) - c.464A>G (Ensembl:ENST00000651687) - p.Glu155Gly (Ensembl:ENST00000504930) - c.464A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs750811316 | 157 | S>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.483) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90506559C>T Codon: TCA/TTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506559C>T Locations: - p.Ser157Leu (Ensembl:ENST00000651687) - c.470C>T (Ensembl:ENST00000651687) - p.Ser157Leu (Ensembl:ENST00000504930) - c.470C>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
COSV67625676 | 158 | D>N | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506561G>A Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506561G>A Locations: - p.Asp158Asn (cosmic curated:ENST00000504930) - c.472G>A (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs957805866 | 159 | E>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90506565A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506565A>G Locations: - p.Glu159Gly (Ensembl:ENST00000504930) - c.476A>G (Ensembl:ENST00000504930) - p.Glu159Gly (Ensembl:ENST00000651687) - c.476A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1427625886 | 159 | E>K | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000005.10:g.90506564G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506564G>A Locations: - p.Glu159Lys (Ensembl:ENST00000651687) - c.475G>A (Ensembl:ENST00000651687) - p.Glu159Lys (Ensembl:ENST00000504930) - c.475G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1300564311 | 161 | N>K | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.68) Somatic: No Accession: NC_000005.10:g.90506572T>G Codon: AAT/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506572T>G Locations: - p.Asn161Lys (Ensembl:ENST00000651687) - c.483T>G (Ensembl:ENST00000651687) - p.Asn161Lys (Ensembl:ENST00000504930) - c.483T>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1580219913 | 161 | N>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.42) Somatic: No Accession: NC_000005.10:g.90506571A>G Codon: AAT/AGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506571A>G Locations: - p.Asn161Ser (Ensembl:ENST00000504930) - c.482A>G (Ensembl:ENST00000504930) - p.Asn161Ser (Ensembl:ENST00000651687) - c.482A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752495689 | 165 | E>K | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.52) Somatic: No Accession: NC_000005.10:g.90506582G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506582G>A Locations: - p.Glu165Lys (Ensembl:ENST00000504930) - c.493G>A (Ensembl:ENST00000504930) - p.Glu165Lys (Ensembl:ENST00000651687) - c.493G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs780643907 | 168 | K>E | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.87) Somatic: No Accession: NC_000005.10:g.90506591A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506591A>G Locations: - p.Lys168Glu (Ensembl:ENST00000504930) - c.502A>G (Ensembl:ENST00000504930) - p.Lys168Glu (Ensembl:ENST00000651687) - c.502A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1306626131 | 170 | K>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90506597A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506597A>G Locations: - p.Lys170Glu (Ensembl:ENST00000651687) - c.508A>G (Ensembl:ENST00000651687) - p.Lys170Glu (Ensembl:ENST00000504930) - c.508A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV101209803 | 172 | K>T | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506604A>C Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506604A>C Locations: - p.Lys172Thr (cosmic curated:ENST00000504930) - c.515A>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs372880869 | 173 | E>K | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.35) Somatic: No Accession: NC_000005.10:g.90506606G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506606G>A Locations: - p.Glu173Lys (Ensembl:ENST00000504930) - c.517G>A (Ensembl:ENST00000504930) - p.Glu173Lys (Ensembl:ENST00000651687) - c.517G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs768132647 | 174 | G>C | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90506609G>T Codon: GGT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506609G>T Locations: - p.Gly174Cys (Ensembl:ENST00000651687) - c.520G>T (Ensembl:ENST00000651687) - p.Gly174Cys (Ensembl:ENST00000504930) - c.520G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs768132647 | 174 | G>S | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.5) Somatic: No Accession: NC_000005.10:g.90506609G>A Codon: GGT/AGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506609G>A Locations: - p.Gly174Ser (Ensembl:ENST00000651687) - c.520G>A (Ensembl:ENST00000651687) - p.Gly174Ser (Ensembl:ENST00000504930) - c.520G>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1325653011 | 175 | D>N | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000005.10:g.90506612G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506612G>A Locations: - p.Asp175Asn (Ensembl:ENST00000504930) - c.523G>A (Ensembl:ENST00000504930) - p.Asp175Asn (Ensembl:ENST00000651687) - c.523G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752497645 | 176 | D>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.22) Somatic: No Accession: NC_000005.10:g.90506616A>C Codon: GAT/GCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506616A>C Locations: - p.Asp176Ala (Ensembl:ENST00000651687) - c.527A>C (Ensembl:ENST00000651687) - p.Asp176Ala (Ensembl:ENST00000504930) - c.527A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs755645191 | 176 | D>H | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90506615G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506615G>C Locations: - p.Asp176His (Ensembl:ENST00000504930) - c.526G>C (Ensembl:ENST00000504930) - p.Asp176His (Ensembl:ENST00000651687) - c.526G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs61741936 | 177 | D>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90506619A>C Codon: GAC/GCC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506619A>C Locations: - p.Asp177Ala (Ensembl:ENST00000651687) - c.530A>C (Ensembl:ENST00000651687) - p.Asp177Ala (Ensembl:ENST00000504930) - c.530A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs548344039 | 177 | D>E | 1000Genomes TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000005.10:g.90506620C>A Codon: GAC/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506620C>A Locations: - p.Asp177Glu (Ensembl:ENST00000651687) - c.531C>A (Ensembl:ENST00000651687) - p.Asp177Glu (Ensembl:ENST00000504930) - c.531C>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1752497772 | 177 | D>N | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000005.10:g.90506618G>A Codon: GAC/AAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506618G>A Locations: - p.Asp177Asn (Ensembl:ENST00000504930) - c.529G>A (Ensembl:ENST00000504930) - p.Asp177Asn (Ensembl:ENST00000651687) - c.529G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs747798005 | 178 | D>N | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000005.10:g.90506621G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506621G>A Locations: - p.Asp178Asn (Ensembl:ENST00000651687) - c.532G>A (Ensembl:ENST00000651687) - p.Asp178Asn (Ensembl:ENST00000504930) - c.532G>A (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1752498775 | 180 | D>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000005.10:g.90506628A>G Codon: GAT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506628A>G Locations: - p.Asp180Gly (Ensembl:ENST00000504930) - c.539A>G (Ensembl:ENST00000504930) - p.Asp180Gly (Ensembl:ENST00000651687) - c.539A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV67625381 rs140910392 | 180 | D>N | cosmic curated 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.05) Somatic: Yes Accession: NC_000005.10:g.90506627G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506627G>A Locations: - p.Asp180Asn (Ensembl:ENST00000651687) - c.538G>A (Ensembl:ENST00000651687) - p.Asp180Asn (Ensembl:ENST00000504930) - c.538G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1420438234 | 181 | D>H | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90506630G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506630G>C Locations: - p.Asp181His (Ensembl:ENST00000651687) - c.541G>C (Ensembl:ENST00000651687) - p.Asp181His (Ensembl:ENST00000504930) - c.541G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625063 rs375576885 | 183 | A>T | cosmic curated ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.31) Somatic: Yes Accession: NC_000005.10:g.90506636G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506636G>A Locations: - p.Ala183Thr (Ensembl:ENST00000651687) - c.547G>A (Ensembl:ENST00000651687) - p.Ala183Thr (Ensembl:ENST00000504930) - c.547G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752499382 | 183 | A>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000005.10:g.90506637C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506637C>T Locations: - p.Ala183Val (Ensembl:ENST00000651687) - c.548C>T (Ensembl:ENST00000651687) - p.Ala183Val (Ensembl:ENST00000504930) - c.548C>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752499525 | 184 | E>K | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000005.10:g.90506639G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506639G>A Locations: - p.Glu184Lys (Ensembl:ENST00000651687) - c.550G>A (Ensembl:ENST00000651687) - p.Glu184Lys (Ensembl:ENST00000504930) - c.550G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1404581969 | 185 | Q>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.32) Somatic: No Accession: NC_000005.10:g.90506643A>G Codon: CAG/CGG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506643A>G Locations: - p.Gln185Arg (Ensembl:ENST00000651687) - c.554A>G (Ensembl:ENST00000651687) - p.Gln185Arg (Ensembl:ENST00000504930) - c.554A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625793 | 187 | E>* | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506648G>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506648G>T Locations: - p.Glu187Ter (cosmic curated:ENST00000504930) - c.559G>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV108248154 | 187 | E>D | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506650A>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506650A>T Locations: - p.Glu187Asp (cosmic curated:ENST00000504930) - c.561A>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67626287 rs1176371426 | 187 | E>K | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000005.10:g.90506648G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506648G>A Locations: - p.Glu187Lys (Ensembl:ENST00000504930) - c.559G>A (Ensembl:ENST00000504930) - p.Glu187Lys (Ensembl:ENST00000651687) - c.559G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs1055430881 | 188 | Y>H | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000005.10:g.90506651T>C Codon: TAT/CAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506651T>C Locations: - p.Tyr188His (Ensembl:ENST00000651687) - c.562T>C (Ensembl:ENST00000651687) - p.Tyr188His (Ensembl:ENST00000504930) - c.562T>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1049068820 | 189 | D>E | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.3) Somatic: No Accession: NC_000005.10:g.90506656T>G Codon: GAT/GAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506656T>G Locations: - p.Asp189Glu (Ensembl:ENST00000651687) - c.567T>G (Ensembl:ENST00000651687) - p.Asp189Glu (Ensembl:ENST00000504930) - c.567T>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV67625120 rs776684072 | 190 | E>D | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.12) Somatic: Yes Accession: NC_000005.10:g.90506659A>C, NC_000005.10:g.90506659A>T Codon: GAA/GAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506659A>C, NC_000005.10:g.90506659A>T Locations: - p.Glu190Asp (Ensembl:ENST00000504930) - c.570A>C (Ensembl:ENST00000504930) - p.Glu190Asp (Ensembl:ENST00000651687) - c.570A>C (Ensembl:ENST00000651687) - c.570A>T (Ensembl:ENST00000651687) - c.570A>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752501020 | 191 | E>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90506660G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506660G>A Locations: - p.Glu191Lys (Ensembl:ENST00000651687) - c.571G>A (Ensembl:ENST00000651687) - p.Glu191Lys (Ensembl:ENST00000504930) - c.571G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs764264318 | 192 | E>K | ExAC | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90506663G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506663G>A Locations: - p.Glu192Lys (Ensembl:ENST00000651687) - c.574G>A (Ensembl:ENST00000651687) - p.Glu192Lys (Ensembl:ENST00000504930) - c.574G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs751745522 | 195 | E>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90506672G>T Codon: GAG/TAG Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506672G>T Locations: - p.Glu195Ter (Ensembl:ENST00000504930) - c.583G>T (Ensembl:ENST00000504930) - p.Glu195Ter (Ensembl:ENST00000651687) - c.583G>T (Ensembl:ENST00000651687) Source type: large scale study | |||||||
rs751745522 | 195 | E>K | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90506672G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90506672G>A Locations: - p.Glu195Lys (Ensembl:ENST00000504930) - c.583G>A (Ensembl:ENST00000504930) - p.Glu195Lys (Ensembl:ENST00000651687) - c.583G>A (Ensembl:ENST00000651687) Source type: large scale study | |||||||
COSV101209846 | 195 | E>Q | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90506672G>C Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90506672G>C Locations: - p.Glu195Gln (cosmic curated:ENST00000504930) - c.583G>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1463823706 | 197 | N>D | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512056A>G Codon: AAT/GAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512056A>G Locations: - p.Asn197Asp (Ensembl:ENST00000504930) - c.589A>G (Ensembl:ENST00000504930) - p.Asn197Asp (Ensembl:ENST00000651687) - c.589A>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1191547193 | 199 | Y>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512063A>G Codon: TAC/TGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512063A>G Locations: - p.Tyr199Cys (Ensembl:ENST00000651687) - c.596A>G (Ensembl:ENST00000651687) - p.Tyr199Cys (Ensembl:ENST00000504930) - c.596A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs777501664 | 200 | I>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512065A>C Codon: ATT/CTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512065A>C Locations: - p.Ile200Leu (Ensembl:ENST00000651687) - c.598A>C (Ensembl:ENST00000651687) - p.Ile200Leu (Ensembl:ENST00000504930) - c.598A>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752764183 | 200 | I>T | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512066T>C Codon: ATT/ACT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512066T>C Locations: - p.Ile200Thr (Ensembl:ENST00000651687) - c.599T>C (Ensembl:ENST00000651687) - p.Ile200Thr (Ensembl:ENST00000504930) - c.599T>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs777501664 | 200 | I>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512065A>G Codon: ATT/GTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512065A>G Locations: - p.Ile200Val (Ensembl:ENST00000651687) - c.598A>G (Ensembl:ENST00000651687) - p.Ile200Val (Ensembl:ENST00000504930) - c.598A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV60057538 | 202 | S>L | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90512072C>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90512072C>T Locations: - p.Ser202Leu (cosmic curated:ENST00000504930) - c.605C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV100270238 | 203 | Y>C | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90512075A>G Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90512075A>G Locations: - p.Tyr203Cys (cosmic curated:ENST00000504930) - c.608A>G (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs568968429 | 204 | F>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512079T>G Codon: TTT/TTG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512079T>G Locations: - p.Phe204Leu (Ensembl:ENST00000504930) - c.612T>G (Ensembl:ENST00000504930) - p.Phe204Leu (Ensembl:ENST00000651687) - c.612T>G (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1451202946 | 204 | F>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512078T>C Codon: TTT/TCT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512078T>C Locations: - p.Phe204Ser (Ensembl:ENST00000651687) - c.611T>C (Ensembl:ENST00000651687) - p.Phe204Ser (Ensembl:ENST00000504930) - c.611T>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752764889 | 205 | E>D | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.83) Somatic: No Accession: NC_000005.10:g.90512082A>T Codon: GAA/GAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512082A>T Locations: - p.Glu205Asp (Ensembl:ENST00000651687) - c.615A>T (Ensembl:ENST00000651687) - p.Glu205Asp (Ensembl:ENST00000504930) - c.615A>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs776635556 | 206 | D>Y | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512083G>T Codon: GAT/TAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512083G>T Locations: - p.Asp206Tyr (Ensembl:ENST00000651687) - c.616G>T (Ensembl:ENST00000651687) - p.Asp206Tyr (Ensembl:ENST00000504930) - c.616G>T (Ensembl:ENST00000504930) Source type: large scale study | |||||||
rs1338201255 | 207 | G>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000005.10:g.90512086G>T Codon: GGA/TGA Consequence type: stop gained Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512086G>T Locations: - p.Gly207Ter (Ensembl:ENST00000651687) - c.619G>T (Ensembl:ENST00000651687) - p.Gly207Ter (Ensembl:ENST00000504930) - c.619G>T (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV60056752 rs745787047 | 207 | G>A | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: Yes Accession: NC_000005.10:g.90512087G>C Codon: GGA/GCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512087G>C Locations: - p.Gly207Ala (Ensembl:ENST00000651687) - c.620G>C (Ensembl:ENST00000651687) - p.Gly207Ala (Ensembl:ENST00000504930) - c.620G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752766489 | 208 | D>G | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000005.10:g.90512090A>G Codon: GAT/GGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512090A>G Locations: - p.Asp208Gly (Ensembl:ENST00000651687) - c.623A>G (Ensembl:ENST00000651687) - p.Asp208Gly (Ensembl:ENST00000504930) - c.623A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1213873365 | 211 | G>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000005.10:g.90512099G>A Codon: GGC/GAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512099G>A Locations: - p.Gly211Asp (Ensembl:ENST00000651687) - c.632G>A (Ensembl:ENST00000651687) - p.Gly211Asp (Ensembl:ENST00000504930) - c.632G>A (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752766816 | 211 | G>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512098G>C Codon: GGC/CGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512098G>C Locations: - p.Gly211Arg (Ensembl:ENST00000504930) - c.631G>C (Ensembl:ENST00000504930) - p.Gly211Arg (Ensembl:ENST00000651687) - c.631G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1561261545 | 212 | A>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512102C>A Codon: GCA/GAA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512102C>A Locations: - p.Ala212Glu (Ensembl:ENST00000504930) - c.635C>A (Ensembl:ENST00000504930) - p.Ala212Glu (Ensembl:ENST00000651687) - c.635C>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV60058248 rs369052283 | 212 | A>T | Variant of uncertain significance (Ensembl) | cosmic curated 1000Genomes ESP TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated (0.06) Somatic: Yes Accession: NC_000005.10:g.90512101G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512101G>A Locations: - p.Ala212Thr (Ensembl:ENST00000504930) - c.634G>A (Ensembl:ENST00000504930) - p.Ala212Thr (Ensembl:ENST00000651687) - c.634G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV60057269 | 212 | A>V | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90512102C>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90512102C>T Locations: - p.Ala212Val (cosmic curated:ENST00000504930) - c.635C>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs774503984 | 213 | D>H | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512104G>C Codon: GAC/CAC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512104G>C Locations: - p.Asp213His (Ensembl:ENST00000504930) - c.637G>C (Ensembl:ENST00000504930) - p.Asp213His (Ensembl:ENST00000651687) - c.637G>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
COSV60057188 | 214 | S>I | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90512108G>T Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90512108G>T Locations: - p.Ser214Ile (cosmic curated:ENST00000504930) - c.641G>T (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV60058259 rs1290660322 | 215 | D>Y | cosmic curated gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: Yes Accession: NC_000005.10:g.90512110G>T Codon: GAT/TAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512110G>T Locations: - p.Asp215Tyr (Ensembl:ENST00000504930) - c.643G>T (Ensembl:ENST00000504930) - p.Asp215Tyr (Ensembl:ENST00000651687) - c.643G>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1580225690 | 217 | N>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512117A>G Codon: AAC/AGC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512117A>G Locations: - p.Asn217Ser (Ensembl:ENST00000651687) - c.650A>G (Ensembl:ENST00000651687) - p.Asn217Ser (Ensembl:ENST00000504930) - c.650A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
COSV60056579 | 217 | N>T | cosmic curated | ||||
Consequence: missense Somatic: Yes Accession: NC_000005.10:g.90512117A>C Consequence type: missense Cytogenetic band: Genomic location: NC_000005.10:g.90512117A>C Locations: - p.Asn217Thr (cosmic curated:ENST00000504930) - c.650A>C (cosmic curated:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1752768662 | 218 | M>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000005.10:g.90512121G>C Codon: ATG/ATC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512121G>C Locations: - p.Met218Ile (Ensembl:ENST00000651687) - c.654G>C (Ensembl:ENST00000651687) - p.Met218Ile (Ensembl:ENST00000504930) - c.654G>C (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs1490391479 | 218 | M>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512120T>C Codon: ATG/ACG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512120T>C Locations: - p.Met218Thr (Ensembl:ENST00000504930) - c.653T>C (Ensembl:ENST00000504930) - p.Met218Thr (Ensembl:ENST00000651687) - c.653T>C (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1224084218 | 219 | D>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512122G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512122G>A Locations: - p.Asp219Asn (Ensembl:ENST00000504930) - c.655G>A (Ensembl:ENST00000504930) - p.Asp219Asn (Ensembl:ENST00000651687) - c.655G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs761986649 | 220 | E>K | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000005.10:g.90512125G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512125G>A Locations: - p.Glu220Lys (Ensembl:ENST00000504930) - c.658G>A (Ensembl:ENST00000504930) - p.Glu220Lys (Ensembl:ENST00000651687) - c.658G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1474730278 | 221 | A>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512128G>T Codon: GCA/TCA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512128G>T Locations: - p.Ala221Ser (Ensembl:ENST00000504930) - c.661G>T (Ensembl:ENST00000504930) - p.Ala221Ser (Ensembl:ENST00000651687) - c.661G>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1474730278 | 221 | A>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512128G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512128G>A Locations: - p.Ala221Thr (Ensembl:ENST00000504930) - c.661G>A (Ensembl:ENST00000504930) - p.Ala221Thr (Ensembl:ENST00000651687) - c.661G>A (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752769290 | 222 | T>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512132C>T Codon: ACC/ATC Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512132C>T Locations: - p.Thr222Ile (Ensembl:ENST00000504930) - c.665C>T (Ensembl:ENST00000504930) - p.Thr222Ile (Ensembl:ENST00000651687) - c.665C>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs183656818 | 223 | Y>C | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512135A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512135A>G Locations: - p.Tyr223Cys (Ensembl:ENST00000651687) - c.668A>G (Ensembl:ENST00000651687) - p.Tyr223Cys (Ensembl:ENST00000504930) - c.668A>G (Ensembl:ENST00000504930) Source type: large scale study Cross-references: | |||||||
rs183656818 | 223 | Y>F | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious (0) Somatic: No Accession: NC_000005.10:g.90512135A>T Codon: TAT/TTT Consequence type: missense Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512135A>T Locations: - p.Tyr223Phe (Ensembl:ENST00000504930) - c.668A>T (Ensembl:ENST00000504930) - p.Tyr223Phe (Ensembl:ENST00000651687) - c.668A>T (Ensembl:ENST00000651687) Source type: large scale study Cross-references: | |||||||
rs1752769962 | 224 | *>F | TOPMed | ||||
Consequence: stop lost Somatic: No Accession: NC_000005.10:g.90512136_90512137dup Codon: TATTAG/TATTTTAG Consequence type: stop lost Cytogenetic band: 5q14.3 Genomic location: NC_000005.10:g.90512136_90512137dup Locations: - p.Ter224PhefsTer12 (Ensembl:ENST00000651687) - c.669_670dup (Ensembl:ENST00000651687) - p.Ter224PhefsTer12 (Ensembl:ENST00000504930) - c.669_670dup (Ensembl:ENST00000504930) Source type: large scale study Cross-references: |