I3L2H8 · I3L2H8_HUMAN
- ProteinMYB binding protein 1a
- GeneMYBBP1A
- StatusUniProtKB unreviewed (TrEMBL)
- Organism
- Amino acids204 (go to sequence)
- Protein existenceEvidence at protein level
- Annotation score1/5
Variants
Variant ID(s) | Position(s) | Change | Description | Clinical significance | Provenance | ||
---|---|---|---|---|---|---|---|
rs201929443 | 3 | P>A | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.401) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000017.11:g.4549441G>C Codon: CCT/GCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549441G>C Locations: - p.Pro3Ala (Ensembl:ENST00000573723) - c.7C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs148415497 | 3 | P>L | ESP TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.963) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549440G>A Codon: CCT/CTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549440G>A Locations: - p.Pro3Leu (Ensembl:ENST00000573723) - c.8C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs201929443 | 3 | P>S | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | 1000Genomes ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.89) - SIFT: deleterious (0.01) Somatic: No Population frequencies: - MAF: 0.0002 (1000Genomes) Accession: NC_000017.11:g.4549441G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549441G>A Locations: - p.P3S (NCI-TCGA:ENST00000573723) - p.Pro3Ser (Ensembl:ENST00000573723) - c.7C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1446359826 | 4 | E>K | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.449) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000017.11:g.4549438C>T Codon: GAG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549438C>T Locations: - p.Glu4Lys (Ensembl:ENST00000573723) - c.10G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1211436284 | 5 | R>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4549435G>A Codon: CGA/TGA Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549435G>A Locations: - p.Arg5Ter (Ensembl:ENST00000573723) - c.13C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs767640756 | 5 | R>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.637) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549434C>A Codon: CGA/CTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549434C>A Locations: - p.Arg5Leu (Ensembl:ENST00000573723) - c.14G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs767640756 | 5 | R>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.857) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549434C>G Codon: CGA/CCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549434C>G Locations: - p.Arg5Pro (Ensembl:ENST00000573723) - c.14G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs767640756 | 5 | R>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.058) - SIFT: tolerated (0.05) Somatic: No Accession: NC_000017.11:g.4549434C>T Codon: CGA/CAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549434C>T Locations: - p.Arg5Gln (Ensembl:ENST00000573723) - c.14G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs568490140 | 9 | R>P | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549422C>G Codon: CGG/CCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549422C>G Locations: - p.Arg9Pro (Ensembl:ENST00000573723) - c.26G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs568490140 | 9 | R>Q | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549422C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549422C>T Locations: - p.Arg9Gln (Ensembl:ENST00000573723) - c.26G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54592982 rs759958263 | 9 | R>W | cosmic curated ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0) Somatic: Yes Accession: NC_000017.11:g.4549423G>A Codon: CGG/TGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549423G>A Locations: - p.Arg9Trp (Ensembl:ENST00000573723) - c.25C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs771389457 | 12 | K>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549414T>G Codon: AAA/CAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549414T>G Locations: - p.Lys12Gln (Ensembl:ENST00000573723) - c.34A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1439215196 | 17 | R>* | TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4549399G>A Codon: CGA/TGA Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549399G>A Locations: - p.Arg17Ter (Ensembl:ENST00000573723) - c.49C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs773733482 | 17 | R>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549398C>A Codon: CGA/CTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549398C>A Locations: - p.Arg17Leu (Ensembl:ENST00000573723) - c.50G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs773733482 | 17 | R>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.929) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549398C>T Codon: CGA/CAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549398C>T Locations: - p.Arg17Gln (Ensembl:ENST00000573723) - c.50G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1907300985 | 20 | S>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.491) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000017.11:g.4549389C>T Codon: AGC/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549389C>T Locations: - p.Ser20Asn (Ensembl:ENST00000573723) - c.59G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1467396109 | 21 | I>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.962) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549386A>C Codon: ATT/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549386A>C Locations: - p.Ile21Ser (Ensembl:ENST00000573723) - c.62T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1467396109 | 21 | I>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.962) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000017.11:g.4549386A>G Codon: ATT/ACT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549386A>G Locations: - p.Ile21Thr (Ensembl:ENST00000573723) - c.62T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907300661 | 21 | I>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.522) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549387T>C Codon: ATT/GTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549387T>C Locations: - p.Ile21Val (Ensembl:ENST00000573723) - c.61A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907299665 | 22 | V>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.344) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4549384C>A Codon: GTG/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549384C>A Locations: - p.Val22Leu (Ensembl:ENST00000573723) - c.64G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs572659000 | 28 | E>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.14) - SIFT: tolerated (1) Somatic: No Accession: NC_000017.11:g.4549366C>T Codon: GAG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549366C>T Locations: - p.Glu28Lys (Ensembl:ENST00000573723) - c.82G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs780559927 | 29 | M>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.5) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549361C>G Codon: ATG/ATC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549361C>G Locations: - p.Met29Ile (Ensembl:ENST00000573723) - c.87G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1478367292 | 29 | M>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.312) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549363T>C Codon: ATG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549363T>C Locations: - p.Met29Val (Ensembl:ENST00000573723) - c.85A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs746901699 | 30 | E>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.974) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4549359T>C Codon: GAG/GGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549359T>C Locations: - p.Glu30Gly (Ensembl:ENST00000573723) - c.89A>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs754576546 | 30 | E>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.621) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000017.11:g.4549360C>G Codon: GAG/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549360C>G Locations: - p.Glu30Gln (Ensembl:ENST00000573723) - c.88G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs746901699 | 30 | E>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.982) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549359T>A Codon: GAG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549359T>A Locations: - p.Glu30Val (Ensembl:ENST00000573723) - c.89A>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV107291696 rs192847046 | 31 | E>A | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000017.11:g.4549356T>G Codon: GAG/GCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549356T>G Locations: - p.Glu31Ala (Ensembl:ENST00000573723) - c.92A>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs144444789 | 32 | A>P | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.955) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000017.11:g.4549354C>G Codon: GCC/CCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549354C>G Locations: - p.Ala32Pro (Ensembl:ENST00000573723) - c.94G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs144444789 | 32 | A>S | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.387) - SIFT: tolerated (0.65) Somatic: No Accession: NC_000017.11:g.4549354C>A Codon: GCC/TCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549354C>A Locations: - p.Ala32Ser (Ensembl:ENST00000573723) - c.94G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1555541949 | 32 | A>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.864) - SIFT: tolerated (0.24) Somatic: No Accession: NC_000017.11:g.4549353G>A Codon: GCC/GTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549353G>A Locations: - p.Ala32Val (Ensembl:ENST00000573723) - c.95C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907295634 | 33 | L>V | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.491) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000017.11:g.4549351A>C Codon: TTG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549351A>C Locations: - p.Leu33Val (Ensembl:ENST00000573723) - c.97T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs750170055 | 34 | T>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.193) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4549348T>C Codon: ACT/GCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549348T>C Locations: - p.Thr34Ala (Ensembl:ENST00000573723) - c.100A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs756225014 | 36 | Q>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.896) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549340C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549340C>G Locations: - p.Gln36His (Ensembl:ENST00000573723) - c.108G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1597386526 | 36 | Q>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.091) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000017.11:g.4549342G>T Codon: CAG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549342G>T Locations: - p.Gln36Lys (Ensembl:ENST00000573723) - c.106C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1303817480 | 36 | Q>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.369) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4549341T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549341T>C Locations: - p.Gln36Arg (Ensembl:ENST00000573723) - c.107A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907293363 | 37 | V>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.143) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4549339C>A Codon: GTG/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549339C>A Locations: - p.Val37Leu (Ensembl:ENST00000573723) - c.109G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs2144485287 | 38 | A>T | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.708) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4549336C>T Codon: GCC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4549336C>T Locations: - p.Ala38Thr (Ensembl:ENST00000573723) - c.112G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs771640983 | 39 | R>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548649C>A Codon: AGG/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548649C>A Locations: - p.Arg39Ser (Ensembl:ENST00000573723) - c.117G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1597385978 | 40 | F>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548648A>C Codon: TTT/GTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548648A>C Locations: - p.Phe40Val (Ensembl:ENST00000573723) - c.118T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs778947883 | 44 | H>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548635T>A Codon: CAC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548635T>A Locations: - p.His44Leu (Ensembl:ENST00000573723) - c.131A>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs770801821 | 44 | H>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548634G>C Codon: CAC/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548634G>C Locations: - p.His44Gln (Ensembl:ENST00000573723) - c.132C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs749059155 | 45 | S>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.64) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548632G>A Codon: TCG/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548632G>A Locations: - p.Ser45Leu (Ensembl:ENST00000573723) - c.134C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs749059155 | 45 | S>W | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.981) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548632G>C Codon: TCG/TGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548632G>C Locations: - p.Ser45Trp (Ensembl:ENST00000573723) - c.134C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1907221542 | 46 | F>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.829) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548628G>T Codon: TTC/TTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548628G>T Locations: - p.Phe46Leu (Ensembl:ENST00000573723) - c.138C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs755184047 | 47 | F>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548627A>G Codon: TTT/CTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548627A>G Locations: - p.Phe47Leu (Ensembl:ENST00000573723) - c.139T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907221177 | 49 | T>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548621T>G Codon: ACA/CCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548621T>G Locations: - p.Thr49Pro (Ensembl:ENST00000573723) - c.145A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1291646566 | 49 | T>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548620G>C Codon: ACA/AGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548620G>C Locations: - p.Thr49Arg (Ensembl:ENST00000573723) - c.146C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs751896212 | 50 | K>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.93) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548617T>C Codon: AAG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548617T>C Locations: - p.Lys50Arg (Ensembl:ENST00000573723) - c.149A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs201321394 | 51 | K>N | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548613C>A Codon: AAG/AAT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548613C>A Locations: - p.Lys51Asn (Ensembl:ENST00000573723) - c.153G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs953313580 | 51 | K>Q | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548615T>G Codon: AAG/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548615T>G Locations: - p.Lys51Gln (Ensembl:ENST00000573723) - c.151A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs375833205 | 53 | T>P | ESP ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.651) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548609T>G Codon: ACA/CCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548609T>G Locations: - p.Thr53Pro (Ensembl:ENST00000573723) - c.157A>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1343298839 | 54 | S>F | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548605G>A Codon: TCC/TTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548605G>A Locations: - p.Ser54Phe (Ensembl:ENST00000573723) - c.161C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907219159 | 54 | S>T | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.862) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000017.11:g.4548606A>T Codon: TCC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548606A>T Locations: - p.Ser54Thr (Ensembl:ENST00000573723) - c.160T>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs750930979 | 55 | Q>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548603G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548603G>A Locations: - p.Gln55Ter (Ensembl:ENST00000573723) - c.163C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1401464467 | 55 | Q>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.86) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548602T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548602T>C Locations: - p.Gln55Arg (Ensembl:ENST00000573723) - c.164A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs765736224 | 56 | I>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.589) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548600T>G Codon: ATC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548600T>G Locations: - p.Ile56Leu (Ensembl:ENST00000573723) - c.166A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs538283667 | 59 | T>A | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.493) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000017.11:g.4548591T>C Codon: ACA/GCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548591T>C Locations: - p.Thr59Ala (Ensembl:ENST00000573723) - c.175A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907216597 | 59 | T>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548590G>A Codon: ACA/ATA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548590G>A Locations: - p.Thr59Ile (Ensembl:ENST00000573723) - c.176C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs538283667 | 59 | T>P | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548591T>G Codon: ACA/CCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548591T>G Locations: - p.Thr59Pro (Ensembl:ENST00000573723) - c.175A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
RCV000887070 rs77807952 | 60 | K>R | Benign (Ensembl, ClinVar) | ClinVar 1000Genomes ESP ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.081) - SIFT: tolerated (0.13) Somatic: No Population frequencies: - MAF: 0.00439 (ClinVar) Accession: NC_000017.11:g.4548587T>C Codon: AAG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548587T>C Locations: - p.Lys60Arg (Ensembl:ENST00000573723) - c.179A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs764375616 | 61 | H>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000017.11:g.4548584T>A Codon: CAC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548584T>A Locations: - p.His61Leu (Ensembl:ENST00000573723) - c.182A>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1338575584 | 61 | H>Y | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.015) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548585G>A Codon: CAC/TAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548585G>A Locations: - p.His61Tyr (Ensembl:ENST00000573723) - c.181C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs182788968 | 62 | P>L | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.026) - SIFT: tolerated (0.49) Somatic: No Accession: NC_000017.11:g.4548581G>A Codon: CCG/CTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548581G>A Locations: - p.Pro62Leu (Ensembl:ENST00000573723) - c.185C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs182788968 | 62 | P>R | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: tolerated (0.55) Somatic: No Accession: NC_000017.11:g.4548581G>C Codon: CCG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548581G>C Locations: - p.Pro62Arg (Ensembl:ENST00000573723) - c.185C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV107291693 rs1907215257 | 62 | P>S | cosmic curated TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.091) - SIFT: tolerated (0.67) Somatic: Yes Accession: NC_000017.11:g.4548582G>A Codon: CCG/TCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548582G>A Locations: - p.Pro62Ser (Ensembl:ENST00000573723) - c.184C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1222798515 | 63 | F>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: tolerated (1) Somatic: No Accession: NC_000017.11:g.4548577G>T Codon: TTC/TTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548577G>T Locations: - p.Phe63Leu (Ensembl:ENST00000573723) - c.189C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs759004145 | 64 | S>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548576A>G Codon: TCC/CCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548576A>G Locations: - p.Ser64Pro (Ensembl:ENST00000573723) - c.190T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs200518396 | 65 | F>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.023) - SIFT: tolerated (0.33) Somatic: No Accession: NC_000017.11:g.4548573A>G Codon: TTC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548573A>G Locations: - p.Phe65Leu (Ensembl:ENST00000573723) - c.193T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907213499 | 66 | P>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.792) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000017.11:g.4548570G>C Codon: CCT/GCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548570G>C Locations: - p.Pro66Ala (Ensembl:ENST00000573723) - c.196C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907213499 | 66 | P>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.958) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548570G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548570G>A Locations: - p.Pro66Ser (Ensembl:ENST00000573723) - c.196C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs770840748 | 67 | L>V | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.7) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548567A>C Codon: TTG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548567A>C Locations: - p.Leu67Val (Ensembl:ENST00000573723) - c.199T>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs777620245 | 71 | A>T | Likely benign (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.041) - SIFT: tolerated (1) Somatic: No Accession: NC_000017.11:g.4548555C>T Codon: GCC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548555C>T Locations: - p.Ala71Thr (Ensembl:ENST00000573723) - c.211G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54594458 rs769769256 | 72 | R>* | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Somatic: Yes Accession: NC_000017.11:g.4548552G>A Codon: CGA/TGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548552G>A Locations: - p.Arg72Ter (Ensembl:ENST00000573723) - c.214C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs769769256 | 72 | R>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548552G>C Codon: CGA/GGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548552G>C Locations: - p.Arg72Gly (Ensembl:ENST00000573723) - c.214C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs747210756 | 72 | R>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548551C>A Codon: CGA/CTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548551C>A Locations: - p.Arg72Leu (Ensembl:ENST00000573723) - c.215G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54597161 rs747210756 | 72 | R>Q | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0.02) Somatic: Yes Accession: NC_000017.11:g.4548551C>T Codon: CGA/CAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548551C>T Locations: - p.Arg72Gln (Ensembl:ENST00000573723) - c.215G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs139874472 | 73 | E>G | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: tolerated (0.31) Somatic: No Accession: NC_000017.11:g.4548548T>C Codon: GAG/GGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548548T>C Locations: - p.Glu73Gly (Ensembl:ENST00000573723) - c.218A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1597385851 | 73 | E>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.14) - SIFT: tolerated (0.24) Somatic: No Accession: NC_000017.11:g.4548549C>T Codon: GAG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548549C>T Locations: - p.Glu73Lys (Ensembl:ENST00000573723) - c.217G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs145991967 | 74 | A>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.641) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000017.11:g.4548546C>A Codon: GCT/TCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548546C>A Locations: - p.Ala74Ser (Ensembl:ENST00000573723) - c.220G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs145991967 | 74 | A>T | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.564) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000017.11:g.4548546C>T Codon: GCT/ACT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548546C>T Locations: - p.Ala74Thr (Ensembl:ENST00000573723) - c.220G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs202178214 | 75 | V>I | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.33) Somatic: No Accession: NC_000017.11:g.4548543C>T Codon: GTC/ATC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548543C>T Locations: - p.Val75Ile (Ensembl:ENST00000573723) - c.223G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs202178214 | 75 | V>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.42) Somatic: No Accession: NC_000017.11:g.4548543C>G Codon: GTC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548543C>G Locations: - p.Val75Leu (Ensembl:ENST00000573723) - c.223G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs376644297 | 76 | S>N | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.525) - SIFT: tolerated (0.2) Somatic: No Accession: NC_000017.11:g.4548539C>T Codon: AGC/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548539C>T Locations: - p.Ser76Asn (Ensembl:ENST00000573723) - c.227G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs756521925 | 77 | S>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.065) - SIFT: tolerated (0.35) Somatic: No Accession: NC_000017.11:g.4548537T>C Codon: AGT/GGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548537T>C Locations: - p.Ser77Gly (Ensembl:ENST00000573723) - c.229A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs753089386 | 77 | S>I | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.97) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548536C>A Codon: AGT/ATT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548536C>A Locations: - p.Ser77Ile (Ensembl:ENST00000573723) - c.230G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs773840677 | 79 | F>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548529G>C Codon: TTC/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548529G>C Locations: - p.Phe79Leu (Ensembl:ENST00000573723) - c.237C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs138114989 | 79 | F>S | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548530A>G Codon: TTC/TCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548530A>G Locations: - p.Phe79Ser (Ensembl:ENST00000573723) - c.236T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs142595127 | 79 | F>V | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548531A>C Codon: TTC/GTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548531A>C Locations: - p.Phe79Val (Ensembl:ENST00000573723) - c.235T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1157299295 | 84 | Q>* | TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548303G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548303G>A Locations: - p.Gln84Ter (Ensembl:ENST00000573723) - c.250C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs774489031 | 84 | Q>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548302T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548302T>C Locations: - p.Gln84Arg (Ensembl:ENST00000573723) - c.251A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs2144478886 | 85 | T>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.476) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000017.11:g.4548299G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548299G>A Locations: - p.Thr85Ile (Ensembl:ENST00000573723) - c.254C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV99627326 rs371564259 | 88 | T>M | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | cosmic curated ESP ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.242) - SIFT: deleterious (0.02) Somatic: Yes Population frequencies: - MAF: 0.00003602 (gnomAD) Accession: NC_000017.11:g.4548290G>A Codon: ACG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548290G>A Locations: - p.T88M (NCI-TCGA:ENST00000573723) - p.Thr88Met (Ensembl:ENST00000573723) - c.263C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1484718330 | 89 | Q>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.026) - SIFT: tolerated (0.49) Somatic: No Accession: NC_000017.11:g.4548287T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548287T>C Locations: - p.Gln89Arg (Ensembl:ENST00000573723) - c.266A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1182816148 | 90 | F>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.01) - SIFT: tolerated (0.73) Somatic: No Accession: NC_000017.11:g.4548283G>T Codon: TTC/TTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548283G>T Locations: - p.Phe90Leu (Ensembl:ENST00000573723) - c.270C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs777840311 | 90 | F>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.181) - SIFT: tolerated (0.57) Somatic: No Accession: NC_000017.11:g.4548285A>C Codon: TTC/GTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548285A>C Locations: - p.Phe90Val (Ensembl:ENST00000573723) - c.268T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs73337533 | 91 | K>R | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.335) - SIFT: tolerated (0.83) Somatic: No Accession: NC_000017.11:g.4548281T>C Codon: AAG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548281T>C Locations: - p.Lys91Arg (Ensembl:ENST00000573723) - c.272A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs142700966 | 93 | A>V | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.041) - SIFT: tolerated (0.56) Somatic: No Accession: NC_000017.11:g.4548275G>A Codon: GCA/GTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548275G>A Locations: - p.Ala93Val (Ensembl:ENST00000573723) - c.278C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs369807606 | 94 | P>L | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.012) - SIFT: tolerated (0.93) Somatic: No Accession: NC_000017.11:g.4548272G>A Codon: CCG/CTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548272G>A Locations: - p.Pro94Leu (Ensembl:ENST00000573723) - c.281C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907180792 | 94 | P>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.264) - SIFT: tolerated (0.41) Somatic: No Accession: NC_000017.11:g.4548273G>A Codon: CCG/TCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548273G>A Locations: - p.Pro94Ser (Ensembl:ENST00000573723) - c.280C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907179928 | 96 | Q>E | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.525) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548267G>C Codon: CAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548267G>C Locations: - p.Gln96Glu (Ensembl:ENST00000573723) - c.286C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs755346830 | 97 | T>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.127) - SIFT: tolerated (0.16) Somatic: No Accession: NC_000017.11:g.4548264T>C Codon: ACC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548264T>C Locations: - p.Thr97Ala (Ensembl:ENST00000573723) - c.289A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs779531050 | 98 | Q>E | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000017.11:g.4548261G>C Codon: CAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548261G>C Locations: - p.Gln98Glu (Ensembl:ENST00000573723) - c.292C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs779531050 | 98 | Q>K | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.083) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000017.11:g.4548261G>T Codon: CAG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548261G>T Locations: - p.Gln98Lys (Ensembl:ENST00000573723) - c.292C>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1234642255 | 99 | G>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.157) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548258C>A Codon: GGT/TGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548258C>A Locations: - p.Gly99Cys (Ensembl:ENST00000573723) - c.295G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1353013671 | 99 | G>D | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.02) - SIFT: tolerated (1) Somatic: No Accession: NC_000017.11:g.4548257C>T Codon: GGT/GAT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548257C>T Locations: - p.Gly99Asp (Ensembl:ENST00000573723) - c.296G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1234642255 | 99 | G>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.905) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548258C>G Codon: GGT/CGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548258C>G Locations: - p.Gly99Arg (Ensembl:ENST00000573723) - c.295G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs758094390 | 100 | G>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.88) - SIFT: tolerated (0.18) Somatic: No Accession: NC_000017.11:g.4548255C>T Codon: GGG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548255C>T Locations: - p.Gly100Arg (Ensembl:ENST00000573723) - c.298G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs758094390 | 100 | G>W | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548255C>A Codon: GGG/TGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548255C>A Locations: - p.Gly100Trp (Ensembl:ENST00000573723) - c.298G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1387686328 | 101 | Q>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548252G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548252G>A Locations: - p.Gln101Ter (Ensembl:ENST00000573723) - c.301C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs9907224 | 101 | Q>H | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.051) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548250C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548250C>G Locations: - p.Gln101His (Ensembl:ENST00000573723) - c.303G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs990257802 | 103 | W>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548244C>A Codon: TGG/TGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548244C>A Locations: - p.Trp103Cys (Ensembl:ENST00000573723) - c.309G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1453432899 | 106 | H>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.641) - SIFT: tolerated (0.28) Somatic: No Accession: NC_000017.11:g.4548237G>T Codon: CAC/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548237G>T Locations: - p.His106Asn (Ensembl:ENST00000573723) - c.316C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV104543273 rs551209985 | 106 | H>R | cosmic curated 1000Genomes ExAC TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.023) - SIFT: tolerated (0.95) Somatic: Yes Accession: NC_000017.11:g.4548236T>C Codon: CAC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548236T>C Locations: - p.His106Arg (Ensembl:ENST00000573723) - c.317A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1167331108 | 108 | V>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.954) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548231C>G Codon: GTG/CTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548231C>G Locations: - p.Val108Leu (Ensembl:ENST00000573723) - c.322G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1167331108 | 108 | V>M | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548231C>T Codon: GTG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548231C>T Locations: - p.Val108Met (Ensembl:ENST00000573723) - c.322G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs753888261 | 109 | Q>* | ExAC gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548228G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548228G>A Locations: - p.Gln109Ter (Ensembl:ENST00000573723) - c.325C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs148075689 | 109 | Q>R | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.85) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000017.11:g.4548227T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548227T>C Locations: - p.Gln109Arg (Ensembl:ENST00000573723) - c.326A>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1907173386 | 111 | A>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548221G>C Codon: GCA/GGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548221G>C Locations: - p.Ala111Gly (Ensembl:ENST00000573723) - c.332C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54602021 rs1263706146 | 111 | A>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.899) - SIFT: deleterious (0.01) Somatic: Yes Accession: NC_000017.11:g.4548222C>T Codon: GCA/ACA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548222C>T Locations: - p.A111T (NCI-TCGA:ENST00000573723) - p.Ala111Thr (Ensembl:ENST00000573723) - c.331G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1597385510 | 112 | D>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.821) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548218T>G Codon: GAC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548218T>G Locations: - p.Asp112Ala (Ensembl:ENST00000573723) - c.335A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1203215441 | 112 | D>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.805) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548217G>T Codon: GAC/GAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548217G>T Locations: - p.Asp112Glu (Ensembl:ENST00000573723) - c.336C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs187168222 | 113 | L>H | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.921) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000017.11:g.4548215A>T Codon: CTC/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548215A>T Locations: - p.Leu113His (Ensembl:ENST00000573723) - c.338T>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs775388575 | 113 | L>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.056) - SIFT: tolerated (0.61) Somatic: No Accession: NC_000017.11:g.4548216G>C Codon: CTC/GTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548216G>C Locations: - p.Leu113Val (Ensembl:ENST00000573723) - c.337C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1350185190 | 114 | L>M | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548213G>T Codon: CTG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548213G>T Locations: - p.Leu114Met (Ensembl:ENST00000573723) - c.340C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs773272369 | 114 | L>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548212A>G Codon: CTG/CCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548212A>G Locations: - p.Leu114Pro (Ensembl:ENST00000573723) - c.341T>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs773272369 | 114 | L>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548212A>C Codon: CTG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548212A>C Locations: - p.Leu114Arg (Ensembl:ENST00000573723) - c.341T>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs781693913 | 115 | L>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548209A>G Codon: TTG/TCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548209A>G Locations: - p.Leu115Ser (Ensembl:ENST00000573723) - c.344T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs769235541 | 116 | N>K | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.34) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000017.11:g.4548205A>T Codon: AAT/AAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548205A>T Locations: - p.Asn116Lys (Ensembl:ENST00000573723) - c.348T>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1387700295 | 116 | N>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.234) - SIFT: tolerated (0.99) Somatic: No Accession: NC_000017.11:g.4548206T>C Codon: AAT/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548206T>C Locations: - p.Asn116Ser (Ensembl:ENST00000573723) - c.347A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs747285935 | 117 | H>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.849) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548203T>G Codon: CAC/CCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548203T>G Locations: - p.His117Pro (Ensembl:ENST00000573723) - c.350A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1567610195 | 118-119 | SH>RC | Ensembl | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548200_4548201insCTGTTTGGAGTGCTCGCCTGTTTGGAGTGCAAACCTGTTCAGTCTAAAAAAAAAGTGTACACCTGC Codon: AGC/AGCAGGTGTACACTTTTTTTTTAGACTGAACAGGTTTGCACTCCAAACAGGCGAGCACTCCAAACAGGC Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548200_4548201insCTGTTTGGAGTGCTCGCCTGTTTGGAGTGCAAACCTGTTCAGTCTAAAAAAAAAGTGTACACCTGC Locations: - p.Ser118_His119insArgCysThrLeuPhePheTer (Ensembl:ENST00000573723) - c.353_354insAGGTGTACACTTTTTTTTTAGACTGAACAGGTTTGCACTCCAAACAGGCGAGCACTCCAAACAGGC (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1328276463 | 119 | H>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.006) - SIFT: tolerated (0.8) Somatic: No Accession: NC_000017.11:g.4548197T>C Codon: CAC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548197T>C Locations: - p.His119Arg (Ensembl:ENST00000573723) - c.356A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs757924192 | 119 | H>Y | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.62) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548198G>A Codon: CAC/TAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548198G>A Locations: - p.His119Tyr (Ensembl:ENST00000573723) - c.355C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1460076598 | 120 | N>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.748) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548195T>C Codon: AAC/GAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548195T>C Locations: - p.Asn120Asp (Ensembl:ENST00000573723) - c.358A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs141617248 | 120 | N>K | ESP TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.748) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548193G>C Codon: AAC/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548193G>C Locations: - p.Asn120Lys (Ensembl:ENST00000573723) - c.360C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1001213326 | 120 | N>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.127) - SIFT: tolerated (0.19) Somatic: No Accession: NC_000017.11:g.4548194T>C Codon: AAC/AGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548194T>C Locations: - p.Asn120Ser (Ensembl:ENST00000573723) - c.359A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs750166636 | 121 | V>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.975) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000017.11:g.4548192C>A Codon: GTG/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548192C>A Locations: - p.Val121Leu (Ensembl:ENST00000573723) - c.361G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54596934 rs750166636 | 121 | V>M | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.996) - SIFT: deleterious (0) Somatic: Yes Population frequencies: - MAF: 0.00002835 (gnomAD) Accession: NC_000017.11:g.4548192C>T Codon: GTG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548192C>T Locations: - p.V121M (NCI-TCGA:ENST00000573723) - p.Val121Met (Ensembl:ENST00000573723) - c.361G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs778557885 | 122 | T>I | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.386) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000017.11:g.4548188G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548188G>A Locations: - p.Thr122Ile (Ensembl:ENST00000573723) - c.365C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs778557885 | 122 | T>N | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.444) - SIFT: tolerated (0.3) Somatic: No Accession: NC_000017.11:g.4548188G>T Codon: ACC/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548188G>T Locations: - p.Thr122Asn (Ensembl:ENST00000573723) - c.365C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1374767622 | 123 | T>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.056) - SIFT: tolerated (0.26) Somatic: No Accession: NC_000017.11:g.4548185G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548185G>A Locations: - p.Thr123Ile (Ensembl:ENST00000573723) - c.368C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1907166921 | 124 | V>G | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.905) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548182A>C Codon: GTG/GGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548182A>C Locations: - p.Val124Gly (Ensembl:ENST00000573723) - c.371T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs375449619 | 124 | V>L | ESP TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.034) - SIFT: tolerated (0.65) Somatic: No Accession: NC_000017.11:g.4548183C>G Codon: GTG/CTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548183C>G Locations: - p.Val124Leu (Ensembl:ENST00000573723) - c.370G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs375449619 | 124 | V>M | ESP TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.912) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548183C>T Codon: GTG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548183C>T Locations: - p.Val124Met (Ensembl:ENST00000573723) - c.370G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs544229293 | 125 | T>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.267) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000017.11:g.4548180T>C Codon: ACA/GCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548180T>C Locations: - p.Thr125Ala (Ensembl:ENST00000573723) - c.373A>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1195191183 | 126 | P>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.7) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000017.11:g.4548177G>C Codon: CCC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548177G>C Locations: - p.Pro126Ala (Ensembl:ENST00000573723) - c.376C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs763901169 | 126 | P>L | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.978) - SIFT: deleterious (0) Somatic: No Population frequencies: - MAF: 0.000004068 (gnomAD) Accession: NC_000017.11:g.4548176G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548176G>A Locations: - p.P126L (NCI-TCGA:ENST00000573723) - p.Pro126Leu (Ensembl:ENST00000573723) - c.377C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs763901169 | 126 | P>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.989) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548176G>C Codon: CCC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548176G>C Locations: - p.Pro126Arg (Ensembl:ENST00000573723) - c.377C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs372864564 | 127 | F>C | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548173A>C Codon: TTC/TGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548173A>C Locations: - p.Phe127Cys (Ensembl:ENST00000573723) - c.380T>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs752366577 | 127 | F>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.224) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000017.11:g.4548172G>C Codon: TTC/TTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548172G>C Locations: - p.Phe127Leu (Ensembl:ENST00000573723) - c.381C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1907165808 | 128 | T>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.533) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4548171T>C Codon: ACT/GCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548171T>C Locations: - p.Thr128Ala (Ensembl:ENST00000573723) - c.382A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs767409469 | 128 | T>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.141) - SIFT: tolerated (0.43) Somatic: No Accession: NC_000017.11:g.4548170G>C Codon: ACT/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548170G>C Locations: - p.Thr128Ser (Ensembl:ENST00000573723) - c.383C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54596572 rs139169505 | 129 | A>V | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.4) - SIFT: tolerated (0.13) Somatic: Yes Accession: NC_000017.11:g.4548167G>A Codon: GCG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548167G>A Locations: - p.Ala129Val (Ensembl:ENST00000573723) - c.386C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1907164705 | 130 | Q>* | gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548165G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548165G>A Locations: - p.Gln130Ter (Ensembl:ENST00000573723) - c.388C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1372276877 | 130 | Q>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.029) - SIFT: tolerated (0.07) Somatic: No Accession: NC_000017.11:g.4548164T>G Codon: CAG/CCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548164T>G Locations: - p.Gln130Pro (Ensembl:ENST00000573723) - c.389A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs761839289 | 131 | Q>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4548162G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548162G>A Locations: - p.Gln131Ter (Ensembl:ENST00000573723) - c.391C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs374976864 | 131 | Q>H | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000017.11:g.4548160C>A Codon: CAG/CAT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548160C>A Locations: - p.Gln131His (Ensembl:ENST00000573723) - c.393G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs768988563 | 132 | R>C | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.218) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000017.11:g.4548159G>A Codon: CGC/TGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548159G>A Locations: - p.Arg132Cys (Ensembl:ENST00000573723) - c.394C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54593027 rs56716962 | 132 | R>H | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious (0.02) Somatic: Yes Accession: NC_000017.11:g.4548158C>T Codon: CGC/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548158C>T Locations: - p.Arg132His (Ensembl:ENST00000573723) - c.395G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs56716962 | 132 | R>L | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.82) - SIFT: deleterious (0) Somatic: No Accession: NC_000017.11:g.4548158C>A Codon: CGC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548158C>A Locations: - p.Arg132Leu (Ensembl:ENST00000573723) - c.395G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs775713896 | 133 | Q>R | Variant of uncertain significance (Ensembl) | ExAC gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.387) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000017.11:g.4548155T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4548155T>C Locations: - p.Gln133Arg (Ensembl:ENST00000573723) - c.398A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1399445026 | 135 | N>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.707) - SIFT: tolerated - low confidence (0.3) Somatic: No Accession: NC_000017.11:g.4539617T>C Codon: AAT/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539617T>C Locations: - p.Asn135Ser (Ensembl:ENST00000573723) - c.404A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1399445026 | 135 | N>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.338) - SIFT: tolerated - low confidence (0.12) Somatic: No Accession: NC_000017.11:g.4539617T>G Codon: AAT/ACT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539617T>G Locations: - p.Asn135Thr (Ensembl:ENST00000573723) - c.404A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1239110648 | 136 | G>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4539614C>T Codon: GGA/GAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539614C>T Locations: - p.Gly136Glu (Ensembl:ENST00000573723) - c.407G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs751088481 | 137 | A>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.289) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000017.11:g.4539612C>T Codon: GCT/ACT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539612C>T Locations: - p.Ala137Thr (Ensembl:ENST00000573723) - c.409G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1255681621 | 138 | P>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.133) - SIFT: tolerated - low confidence (0.25) Somatic: No Accession: NC_000017.11:g.4539609G>A Codon: CCC/TCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539609G>A Locations: - p.Pro138Ser (Ensembl:ENST00000573723) - c.412C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs2144406535 | 139 | G>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.045) - SIFT: tolerated - low confidence (1) Somatic: No Accession: NC_000017.11:g.4539605C>T Codon: GGG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539605C>T Locations: - p.Gly139Glu (Ensembl:ENST00000573723) - c.416G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs372725095 | 139 | G>R | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.027) - SIFT: tolerated - low confidence (0.52) Somatic: No Accession: NC_000017.11:g.4539606C>T Codon: GGG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539606C>T Locations: - p.Gly139Arg (Ensembl:ENST00000573723) - c.415G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs750212138 | 140 | S>C | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.987) - SIFT: deleterious - low confidence (0.05) Somatic: No Accession: NC_000017.11:g.4539602G>C Codon: TCC/TGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539602G>C Locations: - p.Ser140Cys (Ensembl:ENST00000573723) - c.419C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs765078141 | 141 | P>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.948) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539600G>C Codon: CCC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539600G>C Locations: - p.Pro141Ala (Ensembl:ENST00000573723) - c.421C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1267355244 | 141 | P>L | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539599G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539599G>A Locations: - p.Pro141Leu (Ensembl:ENST00000573723) - c.422C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs765078141 | 141 | P>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: tolerated - low confidence (0.17) Somatic: No Accession: NC_000017.11:g.4539600G>A Codon: CCC/TCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539600G>A Locations: - p.Pro141Ser (Ensembl:ENST00000573723) - c.421C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs140870063 | 142 | T>K | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.658) - SIFT: tolerated - low confidence (0.08) Somatic: No Accession: NC_000017.11:g.4539596G>T Codon: ACG/AAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539596G>T Locations: - p.Thr142Lys (Ensembl:ENST00000573723) - c.425C>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54600603 rs140870063 | 142 | T>M | Variant of uncertain significance (Ensembl) | cosmic curated ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.908) - SIFT: tolerated - low confidence (0.06) Somatic: Yes Accession: NC_000017.11:g.4539596G>A Codon: ACG/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539596G>A Locations: - p.Thr142Met (Ensembl:ENST00000573723) - c.425C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs947021386 | 144 | P>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.648) - SIFT: deleterious - low confidence (0.04) Somatic: No Accession: NC_000017.11:g.4539591G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539591G>A Locations: - p.Pro144Ser (Ensembl:ENST00000573723) - c.430C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54600487 rs1362106827 | 145 | A>V | cosmic curated gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.227) - SIFT: tolerated - low confidence (0.06) Somatic: Yes Accession: NC_000017.11:g.4539587G>A Codon: GCA/GTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539587G>A Locations: - p.Ala145Val (Ensembl:ENST00000573723) - c.434C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs2144406244 | 147 | Q>* | Ensembl | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4539582G>A Codon: CAA/TAA Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539582G>A Locations: - p.Gln147Ter (Ensembl:ENST00000573723) - c.439C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906158354 | 147 | Q>H | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.728) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539580T>G Codon: CAA/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539580T>G Locations: - p.Gln147His (Ensembl:ENST00000573723) - c.441A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1183329226 | 148 | K>N | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.963) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539577C>G Codon: AAG/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539577C>G Locations: - p.Lys148Asn (Ensembl:ENST00000573723) - c.444G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs376995985 | 149 | Q>H | ESP ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.162) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539574C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539574C>G Locations: - p.Gln149His (Ensembl:ENST00000573723) - c.447G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs774365134 | 150 | H>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.537) - SIFT: tolerated - low confidence (0.38) Somatic: No Accession: NC_000017.11:g.4539571A>C Codon: CAT/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539571A>C Locations: - p.His150Gln (Ensembl:ENST00000573723) - c.450T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs759644891 | 150 | H>Y | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.045) - SIFT: tolerated - low confidence (1) Somatic: No Accession: NC_000017.11:g.4539573G>A Codon: CAT/TAT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539573G>A Locations: - p.His150Tyr (Ensembl:ENST00000573723) - c.448C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs369842510 | 151 | Q>* | ESP ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4539570G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539570G>A Locations: - p.Gln151Ter (Ensembl:ENST00000573723) - c.451C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs369842510 | 151 | Q>E | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.103) - SIFT: deleterious - low confidence (0.02) Somatic: No Accession: NC_000017.11:g.4539570G>C Codon: CAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539570G>C Locations: - p.Gln151Glu (Ensembl:ENST00000573723) - c.451C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1906157062 | 151 | Q>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.581) - SIFT: tolerated - low confidence (0.08) Somatic: No Accession: NC_000017.11:g.4539569T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539569T>C Locations: - p.Gln151Arg (Ensembl:ENST00000573723) - c.452A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs763421223 | 152 | K>E | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.552) - SIFT: tolerated - low confidence (0.06) Somatic: No Accession: NC_000017.11:g.4539567T>C Codon: AAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539567T>C Locations: - p.Lys152Glu (Ensembl:ENST00000573723) - c.454A>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs562060796 | 152 | K>R | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.948) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539566T>C Codon: AAG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539566T>C Locations: - p.Lys152Arg (Ensembl:ENST00000573723) - c.455A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs770104309 | 154 | L>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539560A>G Codon: CTT/CCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539560A>G Locations: - p.Leu154Pro (Ensembl:ENST00000573723) - c.461T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV99625834 rs1485552738 | 155 | P>L | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic cosmic curated dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.963) - SIFT: deleterious - low confidence (0) Somatic: Yes Population frequencies: - MAF: 0.000003977 (gnomAD) Accession: NC_000017.11:g.4539557G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539557G>A Locations: - p.P155L (NCI-TCGA:ENST00000573723) - p.Pro155Leu (Ensembl:ENST00000573723) - c.464C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1485552738 | 155 | P>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.975) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539557G>C Codon: CCC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539557G>C Locations: - p.Pro155Arg (Ensembl:ENST00000573723) - c.464C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs748517767 | 155 | P>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.433) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539558G>A Codon: CCC/TCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539558G>A Locations: - p.Pro155Ser (Ensembl:ENST00000573723) - c.463C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906155154 | 156 | K>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.867) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539554T>A Codon: AAA/ATA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539554T>A Locations: - p.Lys156Ile (Ensembl:ENST00000573723) - c.467A>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906155154 | 156 | K>T | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.103) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539554T>G Codon: AAA/ACA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539554T>G Locations: - p.Lys156Thr (Ensembl:ENST00000573723) - c.467A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs776251632 | 157 | K>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539551T>G Codon: AAG/ACG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539551T>G Locations: - p.Lys157Thr (Ensembl:ENST00000573723) - c.470A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906154423 | 158 | G>R | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.984) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539549C>G, NC_000017.11:g.4539549C>T Codon: GGG/CGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539549C>G, NC_000017.11:g.4539549C>T Locations: - p.Gly158Arg (Ensembl:ENST00000573723) - c.472G>C (Ensembl:ENST00000573723) - c.472G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs746495821 | 158 | G>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.984) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539548C>A Codon: GGG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539548C>A Locations: - p.Gly158Val (Ensembl:ENST00000573723) - c.473G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs757945492 | 159 | V>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.233) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539545A>G Codon: GTC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539545A>G Locations: - p.Val159Ala (Ensembl:ENST00000573723) - c.476T>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs779477710 | 159 | V>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.554) - SIFT: tolerated - low confidence (0.06) Somatic: No Accession: NC_000017.11:g.4539546C>G Codon: GTC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539546C>G Locations: - p.Val159Leu (Ensembl:ENST00000573723) - c.475G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1597375036 | 161 | G>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: tolerated - low confidence (0.06) Somatic: No Accession: NC_000017.11:g.4539539C>G Codon: GGC/GCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539539C>G Locations: - p.Gly161Ala (Ensembl:ENST00000573723) - c.482G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs745756766 | 161 | G>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.876) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539540C>G Codon: GGC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539540C>G Locations: - p.Gly161Arg (Ensembl:ENST00000573723) - c.481G>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1297190347 | 162 | K>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.552) - SIFT: tolerated - low confidence (0.06) Somatic: No Accession: NC_000017.11:g.4539536T>C Codon: AAA/AGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539536T>C Locations: - p.Lys162Arg (Ensembl:ENST00000573723) - c.485A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1297190347 | 162 | K>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539536T>G Codon: AAA/ACA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539536T>G Locations: - p.Lys162Thr (Ensembl:ENST00000573723) - c.485A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs778995367 | 163 | S>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4539533G>C Codon: TCA/TGA Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539533G>C Locations: - p.Ser163Ter (Ensembl:ENST00000573723) - c.488C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1279548852 | 164 | P>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539530G>A Codon: CCA/CTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539530G>A Locations: - p.Pro164Leu (Ensembl:ENST00000573723) - c.491C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs753748425 | 164 | P>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.648) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539531G>A Codon: CCA/TCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539531G>A Locations: - p.Pro164Ser (Ensembl:ENST00000573723) - c.490C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs151018336 | 166 | S>P | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.211) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539525A>G Codon: TCC/CCC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539525A>G Locations: - p.Ser166Pro (Ensembl:ENST00000573723) - c.496T>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs111416394 | 166 | S>Y | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.991) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539524G>T Codon: TCC/TAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539524G>T Locations: - p.Ser166Tyr (Ensembl:ENST00000573723) - c.497C>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs117506528 | 167 | A>S | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.899) - SIFT: tolerated - low confidence (0.18) Somatic: No Accession: NC_000017.11:g.4539522C>A Codon: GCG/TCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539522C>A Locations: - p.Ala167Ser (Ensembl:ENST00000573723) - c.499G>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54599489 rs117506528 | 167 | A>T | cosmic curated 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.422) - SIFT: tolerated - low confidence (0.14) Somatic: Yes Accession: NC_000017.11:g.4539522C>T Codon: GCG/ACG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539522C>T Locations: - p.Ala167Thr (Ensembl:ENST00000573723) - c.499G>A (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs146547721 | 167 | A>V | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.925) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539521G>A Codon: GCG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539521G>A Locations: - p.Ala167Val (Ensembl:ENST00000573723) - c.500C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs144247987 | 169 | A>V | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.455) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539515G>A Codon: GCA/GTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539515G>A Locations: - p.Ala169Val (Ensembl:ENST00000573723) - c.506C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
COSV54594977 rs768330169 | 170 | R>Q | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.289) - SIFT: tolerated - low confidence (0.1) Somatic: Yes Accession: NC_000017.11:g.4539512C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539512C>T Locations: - p.Arg170Gln (Ensembl:ENST00000573723) - c.509G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs139632940 | 170 | R>W | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.984) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539513G>A Codon: CGG/TGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539513G>A Locations: - p.Arg170Trp (Ensembl:ENST00000573723) - c.508C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1250983276 | 171 | K>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: tolerated - low confidence (0.12) Somatic: No Accession: NC_000017.11:g.4539508T>G Codon: AAA/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539508T>G Locations: - p.Lys171Asn (Ensembl:ENST00000573723) - c.513A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
RCV000947756 rs78578064 | 172 | K>R | Benign (Ensembl, ClinVar) | ClinVar 1000Genomes ESP ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.312) - SIFT: deleterious - low confidence (0) Somatic: No Population frequencies: - MAF: 0.02117 (ClinVar) Accession: NC_000017.11:g.4539506T>C Codon: AAG/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539506T>C Locations: - p.Lys172Arg (Ensembl:ENST00000573723) - c.515A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1480800927 | 173 | A>P | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.984) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539504C>G Codon: GCA/CCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539504C>G Locations: - p.Ala173Pro (Ensembl:ENST00000573723) - c.517G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54605430 rs1480800927 | 173 | A>S | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.552) - SIFT: deleterious - low confidence (0) Somatic: Yes Accession: NC_000017.11:g.4539504C>A Codon: GCA/TCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539504C>A Locations: - p.Ala173Ser (Ensembl:ENST00000573723) - c.517G>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs775236687 | 173 | A>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.962) - SIFT: deleterious - low confidence (0.05) Somatic: No Accession: NC_000017.11:g.4539503G>A Codon: GCA/GTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539503G>A Locations: - p.Ala173Val (Ensembl:ENST00000573723) - c.518C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1340892929 | 174 | R>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539499C>A, NC_000017.11:g.4539499C>G Codon: AGG/AGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539499C>A, NC_000017.11:g.4539499C>G Locations: - p.Arg174Ser (Ensembl:ENST00000573723) - c.522G>T (Ensembl:ENST00000573723) - c.522G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs745380894 | 175 | L>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.988) - SIFT: tolerated - low confidence (0.11) Somatic: No Accession: NC_000017.11:g.4539497A>G Codon: CTG/CCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539497A>G Locations: - p.Leu175Pro (Ensembl:ENST00000573723) - c.524T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1301118565 | 176 | S>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.981) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4539495A>C Codon: TCT/GCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539495A>C Locations: - p.Ser176Ala (Ensembl:ENST00000573723) - c.526T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1392357426 | 176 | S>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.997) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539494G>C Codon: TCT/TGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539494G>C Locations: - p.Ser176Cys (Ensembl:ENST00000573723) - c.527C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54594371 rs1392357426 | 176 | S>F | cosmic curated TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.997) - SIFT: deleterious - low confidence (0) Somatic: Yes Accession: NC_000017.11:g.4539494G>A Codon: TCT/TTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539494G>A Locations: - p.Ser176Phe (Ensembl:ENST00000573723) - c.527C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs757334739 | 179 | I>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.175) - SIFT: tolerated - low confidence (0.06) Somatic: No Accession: NC_000017.11:g.4539486T>G Codon: ATC/CTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539486T>G Locations: - p.Ile179Leu (Ensembl:ENST00000573723) - c.535A>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs777480813 | 179 | I>M | ExAC | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.728) - SIFT: deleterious - low confidence (0.03) Somatic: No Accession: NC_000017.11:g.4539484G>C Codon: ATC/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539484G>C Locations: - p.Ile179Met (Ensembl:ENST00000573723) - c.537C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs749064539 | 179 | I>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated - low confidence (1) Somatic: No Accession: NC_000017.11:g.4539485A>C Codon: ATC/AGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539485A>C Locations: - p.Ile179Ser (Ensembl:ENST00000573723) - c.536T>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs749064539 | 179 | I>T | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.02) - SIFT: tolerated - low confidence (0.33) Somatic: No Accession: NC_000017.11:g.4539485A>G Codon: ATC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539485A>G Locations: - p.Ile179Thr (Ensembl:ENST00000573723) - c.536T>C (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs751693673 | 180 | R>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.125) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539483T>C Codon: AGG/GGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539483T>C Locations: - p.Arg180Gly (Ensembl:ENST00000573723) - c.538A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1041869574 | 180 | R>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.857) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539481C>G Codon: AGG/AGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539481C>G Locations: - p.Arg180Ser (Ensembl:ENST00000573723) - c.540G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs766628903 | 181 | S>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.918) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539479C>G Codon: AGT/ACT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539479C>G Locations: - p.Ser181Thr (Ensembl:ENST00000573723) - c.542G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906141865 | 182 | P>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.999) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539476G>C Codon: CCC/CGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539476G>C Locations: - p.Pro182Arg (Ensembl:ENST00000573723) - c.545C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1567600963 | 185 | L>F | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.211) - SIFT: tolerated - low confidence (0.07) Somatic: No Accession: NC_000017.11:g.4539468G>A Codon: CTT/TTT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539468G>A Locations: - p.Leu185Phe (Ensembl:ENST00000573723) - c.553C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs896700745 | 186 | Q>* | TOPMed | ||||
Consequence: stop gained Somatic: No Accession: NC_000017.11:g.4539465G>A Codon: CAG/TAG Consequence type: stop gained Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539465G>A Locations: - p.Gln186Ter (Ensembl:ENST00000573723) - c.556C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1406217920 | 186 | Q>H | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.972) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539463C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539463C>G Locations: - p.Gln186His (Ensembl:ENST00000573723) - c.558G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs765700552 | 186 | Q>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.913) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539464T>A Codon: CAG/CTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539464T>A Locations: - p.Gln186Leu (Ensembl:ENST00000573723) - c.557A>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs762354892 | 187 | S>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.125) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539462T>C Codon: AGT/GGT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539462T>C Locations: - p.Ser187Gly (Ensembl:ENST00000573723) - c.559A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54603997 rs777143514 | 187 | S>N | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.893) - SIFT: deleterious - low confidence (0) Somatic: Yes Accession: NC_000017.11:g.4539461C>T Codon: AGT/AAT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539461C>T Locations: - p.Ser187Asn (Ensembl:ENST00000573723) - c.560G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs764322847 | 189 | A>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.962) - SIFT: tolerated - low confidence (0.13) Somatic: No Accession: NC_000017.11:g.4539456C>T Codon: GCC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539456C>T Locations: - p.Ala189Thr (Ensembl:ENST00000573723) - c.565G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs761101989 | 190 | K>E | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.948) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539453T>C Codon: AAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539453T>C Locations: - p.Lys190Glu (Ensembl:ENST00000573723) - c.568A>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1240352931 | 190 | K>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.977) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539451C>G Codon: AAG/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539451C>G Locations: - p.Lys190Asn (Ensembl:ENST00000573723) - c.570G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs112418856 | 191 | K>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.882) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000017.11:g.4539450T>C Codon: AAG/GAG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539450T>C Locations: - p.Lys191Glu (Ensembl:ENST00000573723) - c.571A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
COSV54604049 rs774944643 | 193 | A>T | cosmic curated ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.45) - SIFT: tolerated - low confidence (0.38) Somatic: Yes Accession: NC_000017.11:g.4539444C>T Codon: GCA/ACA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539444C>T Locations: - p.Ala193Thr (Ensembl:ENST00000573723) - c.577G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1305296304 | 193 | A>V | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.048) - SIFT: tolerated - low confidence (1) Somatic: No Accession: NC_000017.11:g.4539443G>A Codon: GCA/GTA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539443G>A Locations: - p.Ala193Val (Ensembl:ENST00000573723) - c.578C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906136144 | 194 | Q>P | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.435) - SIFT: tolerated - low confidence (0.11) Somatic: No Accession: NC_000017.11:g.4539440T>G Codon: CAG/CCG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4539440T>G Locations: - p.Gln194Pro (Ensembl:ENST00000573723) - c.581A>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs761759907 | 195 | T>I | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.642) - SIFT: tolerated - low confidence (0.05) Somatic: No Accession: NC_000017.11:g.4538974G>A Codon: ACT/ATT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538974G>A Locations: - p.Thr195Ile (Ensembl:ENST00000573723) - c.584C>T (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906055813 | 196 | L>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.902) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000017.11:g.4538972G>C Codon: CTG/GTG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538972G>C Locations: - p.Leu196Val (Ensembl:ENST00000573723) - c.586C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs972791750 | 197 | R>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.807) - SIFT: tolerated - low confidence (0.31) Somatic: No Accession: NC_000017.11:g.4538968C>T Codon: AGA/AAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538968C>T Locations: - p.Arg197Lys (Ensembl:ENST00000573723) - c.590G>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs746817244 | 198 | F>C | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.967) Somatic: No Accession: NC_000017.11:g.4538965A>C Codon: TTC/TGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538965A>C Locations: - p.Phe198Cys (Ensembl:ENST00000573723) - c.593T>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs1906053271 | 199 | T>A | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.871) Somatic: No Accession: NC_000017.11:g.4538963T>C Codon: ACA/GCA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538963T>C Locations: - p.Thr199Ala (Ensembl:ENST00000573723) - c.595A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs774539167 | 199 | T>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.96) Somatic: No Accession: NC_000017.11:g.4538962G>A Codon: ACA/ATA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538962G>A Locations: - p.Thr199Ile (Ensembl:ENST00000573723) - c.596C>T (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs774539167 | 199 | T>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.973) Somatic: No Accession: NC_000017.11:g.4538962G>C Codon: ACA/AGA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538962G>C Locations: - p.Thr199Arg (Ensembl:ENST00000573723) - c.596C>G (Ensembl:ENST00000573723) Source type: large scale study | |||||||
rs756173574 | 200 | I>M | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.05) Somatic: No Accession: NC_000017.11:g.4538958G>C Codon: ATC/ATG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538958G>C Locations: - p.Ile200Met (Ensembl:ENST00000573723) - c.600C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs777962669 | 200 | I>N | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.73) Somatic: No Accession: NC_000017.11:g.4538959A>T Codon: ATC/AAC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538959A>T Locations: - p.Ile200Asn (Ensembl:ENST00000573723) - c.599T>A (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs777962669 | 200 | I>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.521) Somatic: No Accession: NC_000017.11:g.4538959A>C Codon: ATC/AGC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538959A>C Locations: - p.Ile200Ser (Ensembl:ENST00000573723) - c.599T>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs575879715 | 200 | I>V | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.093) Somatic: No Accession: NC_000017.11:g.4538960T>C Codon: ATC/GTC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538960T>C Locations: - p.Ile200Val (Ensembl:ENST00000573723) - c.598A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs748652173 | 201 | S>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.936) Somatic: No Accession: NC_000017.11:g.4538955G>C Codon: AGC/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538955G>C Locations: - p.Ser201Arg (Ensembl:ENST00000573723) - c.603C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906050920 | 202 | S>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.584) Somatic: No Accession: NC_000017.11:g.4538952G>C Codon: AGC/AGG Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538952G>C Locations: - p.Ser202Arg (Ensembl:ENST00000573723) - c.606C>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs781766107 | 202 | S>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.653) Somatic: No Accession: NC_000017.11:g.4538953C>G Codon: AGC/ACC Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538953C>G Locations: - p.Ser202Thr (Ensembl:ENST00000573723) - c.605G>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1906050704 | 203 | S>P | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.024) Somatic: No Accession: NC_000017.11:g.4538951A>G Codon: TCT/CCT Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538951A>G Locations: - p.Ser203Pro (Ensembl:ENST00000573723) - c.607T>C (Ensembl:ENST00000573723) Source type: large scale study Cross-references: | |||||||
rs1462112545 | 204 | K>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.833) Somatic: No Accession: NC_000017.11:g.4538948T>C Codon: AAA/GAA Consequence type: missense Cytogenetic band: 17p13.2 Genomic location: NC_000017.11:g.4538948T>C Locations: - p.Lys204Glu (Ensembl:ENST00000573723) - c.610A>G (Ensembl:ENST00000573723) Source type: large scale study Cross-references: |