F8WBT6 · F8WBT6_HUMAN
- ProteinSirtuin 2
- GeneSIRT2
- StatusUniProtKB unreviewed (TrEMBL)
- Organism
- Amino acids
- Protein existenceEvidence at protein level
- Annotation score1/5
Variants
Variant ID(s) | Position(s) | Change | Description | Clinical significance | Provenance | ||
---|---|---|---|---|---|---|---|
rs899219004 | 2 | A>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.309190C>G Codon: GCA/CCA Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.309190C>G Locations: - p.Ala2Pro (Ensembl:ENST00000635694) - c.4G>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs2144714856 | 4 | P>T | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.309184G>T Codon: CCA/ACA Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.309184G>T Locations: - p.Pro4Thr (Ensembl:ENST00000635694) - c.10C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1431209574 | 5 | D>N | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38899509C>T Codon: GAC/AAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38899509C>T Locations: - p.Asp5Asn (Ensembl:ENST00000443898) - c.13G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs748872953 | 6 | P>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38899506G>C Codon: CCC/GCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38899506G>C Locations: - p.Pro6Ala (Ensembl:ENST00000443898) - c.16C>G (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs904071840 | 6 | P>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38898425G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898425G>A Locations: - p.Pro6Leu (Ensembl:ENST00000443898) - c.17C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973802812 | 7 | S>C | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.16) Somatic: No Accession: NC_000019.10:g.38898422G>C Codon: TCT/TGT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898422G>C Locations: - p.Ser7Cys (Ensembl:ENST00000443898) - c.20C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs774995182 | 8 | H>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.67) Somatic: No Accession: NW_014040929.1:g.308091T>A Codon: CAC/CTC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308091T>A Locations: - p.His8Leu (Ensembl:ENST00000635694) - c.23A>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs774995182 | 8 | H>Y | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.75) Somatic: No Accession: NC_000019.10:g.38898420G>A Codon: CAC/TAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898420G>A Locations: - p.His8Tyr (Ensembl:ENST00000443898) - c.22C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1362615136 | 9 | P>H | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0.05) Somatic: No Accession: NW_014040929.1:g.308088G>T Codon: CCT/CAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308088G>T Locations: - p.Pro9His (Ensembl:ENST00000635694) - c.26C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs202225244 | 9 | P>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (1) Somatic: No Accession: NW_014040929.1:g.308089G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308089G>A Locations: - p.Pro9Ser (Ensembl:ENST00000635694) - c.25C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1362615136 | 9 | P>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.28) Somatic: No Accession: NC_000019.10:g.38898417G>T Codon: CCT/ACT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898417G>T Locations: - p.Pro9Thr (Ensembl:ENST00000443898) - c.25C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1418810049 | 12 | T>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.16) Somatic: No Accession: NC_000019.10:g.38898407G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898407G>A Locations: - p.Thr12Ile (Ensembl:ENST00000443898) - c.35C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1378303685 | 13 | Q>K | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.56) Somatic: No Accession: NW_014040929.1:g.308077G>T Codon: CAG/AAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308077G>T Locations: - p.Gln13Lys (Ensembl:ENST00000635694) - c.37C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1473123135 | 14 | A>P | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.09) Somatic: No Accession: NC_000019.10:g.38898402C>G Codon: GCA/CCA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898402C>G Locations: - p.Ala14Pro (Ensembl:ENST00000443898) - c.40G>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs199857400 | 14 | A>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.19) Somatic: No Accession: NW_014040929.1:g.308074C>T Codon: GCA/ACA Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308074C>T Locations: - p.Ala14Thr (Ensembl:ENST00000635694) - c.40G>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1428015087 | 17 | V>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.09) Somatic: No Accession: NW_014040929.1:g.308064A>T Codon: GTG/GAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308064A>T Locations: - p.Val17Glu (Ensembl:ENST00000635694) - c.50T>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs776314748 | 17 | V>E | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.09) Somatic: No Accession: NC_000019.10:g.38898392A>T Codon: GTG/GAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898392A>T Locations: - p.Val17Glu (Ensembl:ENST00000443898) - c.50T>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1428015087 | 17 | V>M | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.1) Somatic: No Accession: NC_000019.10:g.38898393C>T Codon: GTG/ATG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898393C>T Locations: - p.Val17Met (Ensembl:ENST00000443898) - c.49G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1293047926 | 18 | Q>H | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.21) Somatic: No Accession: NW_014040929.1:g.308060C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308060C>G Locations: - p.Gln18His (Ensembl:ENST00000635694) - c.54G>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs201682459 | 18 | Q>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.21) Somatic: No Accession: NC_000019.10:g.38898388C>G Codon: CAG/CAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898388C>G Locations: - p.Gln18His (Ensembl:ENST00000443898) - c.54G>C (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1293047926 | 18 | Q>P | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.35) Somatic: No Accession: NC_000019.10:g.38898389T>G Codon: CAG/CCG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898389T>G Locations: - p.Gln18Pro (Ensembl:ENST00000443898) - c.53A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs201682459 | 19 | E>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.41) Somatic: No Accession: NW_014040929.1:g.308059C>G Codon: GAG/CAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308059C>G Locations: - p.Glu19Gln (Ensembl:ENST00000635694) - c.55G>C (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs1600134981 | 20 | A>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.308055G>T Codon: GCT/GAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308055G>T Locations: - p.Ala20Asp (Ensembl:ENST00000635694) - c.59C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600134981 | 20 | A>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38898384C>A Codon: GCT/TCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898384C>A Locations: - p.Ala20Ser (Ensembl:ENST00000443898) - c.58G>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600134981 | 20 | A>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38898384C>T Codon: GCT/ACT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898384C>T Locations: - p.Ala20Thr (Ensembl:ENST00000443898) - c.58G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs746872375 | 20 | A>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.308056C>T Codon: GCT/ACT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308056C>T Locations: - p.Ala20Thr (Ensembl:ENST00000635694) - c.58G>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600134981 | 20 | A>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.308055G>A Codon: GCT/GTT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.308055G>A Locations: - p.Ala20Val (Ensembl:ENST00000635694) - c.59C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs777560427 | 20 | A>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38898383G>A Codon: GCT/GTT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38898383G>A Locations: - p.Ala20Val (Ensembl:ENST00000443898) - c.59C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1600127508 | 22 | A>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893971C>G Codon: GCC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893971C>G Locations: - p.Ala22Pro (Ensembl:ENST00000443898) - c.64G>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973634048 | 23 | T>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893967G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893967G>A Locations: - p.Thr23Ile (Ensembl:ENST00000443898) - c.68C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973634048 | 23 | T>N | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893967G>T Codon: ACC/AAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893967G>T Locations: - p.Thr23Asn (Ensembl:ENST00000443898) - c.68C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600127506 | 23 | T>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893968T>G Codon: ACC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893968T>G Locations: - p.Thr23Pro (Ensembl:ENST00000443898) - c.67A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600127502 | 24 | F>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893964A>G Codon: TTC/TCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893964A>G Locations: - p.Phe24Ser (Ensembl:ENST00000443898) - c.71T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs764650317 | 28 | P>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893953G>C Codon: CCT/GCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893953G>C Locations: - p.Pro28Ala (Ensembl:ENST00000443898) - c.82C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs764650317 | 28 | P>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303624G>C Codon: CCT/CGT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303624G>C Locations: - p.Pro28Arg (Ensembl:ENST00000635694) - c.83C>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1239276586 | 29 | F>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893949A>G Codon: TTT/TCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893949A>G Locations: - p.Phe29Ser (Ensembl:ENST00000443898) - c.86T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs753287850 | 30 | P>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893946G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893946G>A Locations: - p.Pro30Leu (Ensembl:ENST00000443898) - c.89C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600127463 | 32 | T>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893941T>G Codon: ACC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893941T>G Locations: - p.Thr32Pro (Ensembl:ENST00000443898) - c.94A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973633249 | 33 | W>* | TOPMed | ||||
Consequence: stop gained Somatic: No Accession: NC_000019.10:g.38893936C>T Codon: TGG/TGA Consequence type: stop gained Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893936C>T Locations: - p.Trp33Ter (Ensembl:ENST00000443898) - c.99G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1014813069 | 33 | W>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303610A>C Codon: TGG/GGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303610A>C Locations: - p.Trp33Gly (Ensembl:ENST00000635694) - c.97T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973633249 | 34 | Y>N | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303607A>T Codon: TAT/AAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303607A>T Locations: - p.Tyr34Asn (Ensembl:ENST00000635694) - c.100T>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600127456 | 35 | H>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893931T>G Codon: CAC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893931T>G Locations: - p.His35Pro (Ensembl:ENST00000443898) - c.104A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs765880619 | 35 | H>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893930G>T Codon: CAC/CAA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893930G>T Locations: - p.His35Gln (Ensembl:ENST00000443898) - c.105C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs765880619 | 36 | P>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303601G>T Codon: CCC/ACC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303601G>T Locations: - p.Pro36Thr (Ensembl:ENST00000635694) - c.106C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1221151482 | 37 | L>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0.02) Somatic: No Accession: NW_014040929.1:g.303597A>C Codon: CTC/CGC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303597A>C Locations: - p.Leu37Arg (Ensembl:ENST00000635694) - c.110T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1221151482 | 37 | L>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.49) Somatic: No Accession: NC_000019.10:g.38893926G>C Codon: CTC/GTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893926G>C Locations: - p.Leu37Val (Ensembl:ENST00000443898) - c.109C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs760335318 | 38 | S>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.32) Somatic: No Accession: NW_014040929.1:g.303595A>C Codon: TCC/GCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303595A>C Locations: - p.Ser38Ala (Ensembl:ENST00000635694) - c.112T>G (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs1278466341 | 38 | S>F | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0.03) Somatic: No Accession: NC_000019.10:g.38893922G>A Codon: TCC/TTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893922G>A Locations: - p.Ser38Phe (Ensembl:ENST00000443898) - c.113C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs558087757 | 40 | L>F | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303589G>A Codon: CTC/TTC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303589G>A Locations: - p.Leu40Phe (Ensembl:ENST00000635694) - c.118C>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs1467196272 | 40 | L>R | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303588A>C Codon: CTC/CGC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303588A>C Locations: - p.Leu40Arg (Ensembl:ENST00000635694) - c.119T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1467196272 | 40 | L>V | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893917G>C Codon: CTC/GTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893917G>C Locations: - p.Leu40Val (Ensembl:ENST00000443898) - c.118C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1354183561 | 41 | P>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303586G>C Codon: CCT/GCT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303586G>C Locations: - p.Pro41Ala (Ensembl:ENST00000635694) - c.121C>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1255963426 | 41 | P>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303585G>A Codon: CCT/CTT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303585G>A Locations: - p.Pro41Leu (Ensembl:ENST00000635694) - c.122C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1255963426 | 41 | P>S | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893914G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893914G>A Locations: - p.Pro41Ser (Ensembl:ENST00000443898) - c.121C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973631858 | 43 | P>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893907G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893907G>A Locations: - p.Pro43Leu (Ensembl:ENST00000443898) - c.128C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs771881617 | 43 | P>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303579G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303579G>A Locations: - p.Pro43Leu (Ensembl:ENST00000635694) - c.128C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs771881617 | 43 | P>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893908G>A Codon: CCC/TCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893908G>A Locations: - p.Pro43Ser (Ensembl:ENST00000443898) - c.127C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600127395 | 44 | T>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.05) Somatic: No Accession: NC_000019.10:g.38893905T>G Codon: ACC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893905T>G Locations: - p.Thr44Pro (Ensembl:ENST00000443898) - c.130A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs761558022 | 45 | S>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303574A>C Codon: TCT/GCT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303574A>C Locations: - p.Ser45Ala (Ensembl:ENST00000635694) - c.133T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973631384 | 45 | S>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893901G>C Codon: TCT/TGT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893901G>C Locations: - p.Ser45Cys (Ensembl:ENST00000443898) - c.134C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973631482 | 45 | S>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893902A>G Codon: TCT/CCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893902A>G Locations: - p.Ser45Pro (Ensembl:ENST00000443898) - c.133T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs201572470 | 46 | R>L | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.68) Somatic: No Accession: NW_014040929.1:g.303570C>A Codon: CGG/CTG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303570C>A Locations: - p.Arg46Leu (Ensembl:ENST00000635694) - c.137G>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs569482532 | 46 | R>P | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.35) Somatic: No Accession: NC_000019.10:g.38893898C>G Codon: CGG/CCG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893898C>G Locations: - p.Arg46Pro (Ensembl:ENST00000443898) - c.137G>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs569482532 | 46 | R>Q | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.62) Somatic: No Accession: NC_000019.10:g.38893898C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893898C>T Locations: - p.Arg46Gln (Ensembl:ENST00000443898) - c.137G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs201572470 | 46 | R>Q | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.62) Somatic: No Accession: NW_014040929.1:g.303570C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303570C>T Locations: - p.Arg46Gln (Ensembl:ENST00000635694) - c.137G>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs201572470 | 46 | R>W | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.16) Somatic: No Accession: NC_000019.10:g.38893899G>A Codon: CGG/TGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893899G>A Locations: - p.Arg46Trp (Ensembl:ENST00000443898) - c.136C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1302977371 | 47 | A>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893896C>A Codon: GCC/TCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893896C>A Locations: - p.Ala47Ser (Ensembl:ENST00000443898) - c.139G>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1302977371 | 47 | A>V | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303567G>A Codon: GCC/GTC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303567G>A Locations: - p.Ala47Val (Ensembl:ENST00000635694) - c.140C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973630792 | 48 | W>G | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303565A>C Codon: TGG/GGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303565A>C Locations: - p.Trp48Gly (Ensembl:ENST00000635694) - c.142T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs780238478 | 50 | L>F | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.24) Somatic: No Accession: NC_000019.10:g.38893887G>A Codon: CTC/TTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893887G>A Locations: - p.Leu50Phe (Ensembl:ENST00000443898) - c.148C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs780238478 | 50 | L>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.19) Somatic: No Accession: NW_014040929.1:g.303558A>C Codon: CTC/CGC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303558A>C Locations: - p.Leu50Arg (Ensembl:ENST00000635694) - c.149T>G (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs780238478 | 50 | L>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.47) Somatic: No Accession: NC_000019.10:g.38893887G>C Codon: CTC/GTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893887G>C Locations: - p.Leu50Val (Ensembl:ENST00000443898) - c.148C>G (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1973630472 | 51 | H>D | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303556G>C Codon: CAC/GAC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303556G>C Locations: - p.His51Asp (Ensembl:ENST00000635694) - c.151C>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600127341 | 51 | H>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893883T>G Codon: CAC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893883T>G Locations: - p.His51Pro (Ensembl:ENST00000443898) - c.152A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1431695218 | 52 | P>H | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893880G>T Codon: CCC/CAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893880G>T Locations: - p.Pro52His (Ensembl:ENST00000443898) - c.155C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs770012585 | 52 | P>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303553G>A Codon: CCC/TCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303553G>A Locations: - p.Pro52Ser (Ensembl:ENST00000635694) - c.154C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs746076601 | 53 | T>A | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303550T>C Codon: ACC/GCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303550T>C Locations: - p.Thr53Ala (Ensembl:ENST00000635694) - c.157A>G (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs781308825 | 53 | T>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303549G>A Codon: ACC/ATC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303549G>A Locations: - p.Thr53Ile (Ensembl:ENST00000635694) - c.158C>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs781308825 | 53 | T>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893878T>G Codon: ACC/CCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893878T>G Locations: - p.Thr53Pro (Ensembl:ENST00000443898) - c.157A>C (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs781308825 | 53 | T>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893878T>A Codon: ACC/TCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893878T>A Locations: - p.Thr53Ser (Ensembl:ENST00000443898) - c.157A>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs746076601 | 53 | T>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303550T>A Codon: ACC/TCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303550T>A Locations: - p.Thr53Ser (Ensembl:ENST00000635694) - c.157A>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs1973629795 | 54 | P>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303547G>A Codon: CCT/TCT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303547G>A Locations: - p.Pro54Ser (Ensembl:ENST00000635694) - c.160C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973629795 | 54 | P>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303547G>T Codon: CCT/ACT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303547G>T Locations: - p.Pro54Thr (Ensembl:ENST00000635694) - c.160C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs757636746 | 56 | R>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893869T>C Codon: AGG/GGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893869T>C Locations: - p.Arg56Gly (Ensembl:ENST00000443898) - c.166A>G (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs370835884 | 56 | R>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893867C>A Codon: AGG/AGT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893867C>A Locations: - p.Arg56Ser (Ensembl:ENST00000443898) - c.168G>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs778123159 | 57 | T>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893865G>A Codon: ACT/ATT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893865G>A Locations: - p.Thr57Ile (Ensembl:ENST00000443898) - c.170C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs370835884 | 57 | T>S | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303538T>A Codon: ACT/TCT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303538T>A Locations: - p.Thr57Ser (Ensembl:ENST00000635694) - c.169A>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs758838464 | 58 | Q>* | ExAC gnomAD | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893863G>A Codon: TCA/TTA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893863G>A Locations: - p.Gln58Ter (Ensembl:ENST00000443898) - c.172C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs758838464 | 58 | Q>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303534T>A Codon: CAG/CTG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303534T>A Locations: - p.Gln58Leu (Ensembl:ENST00000635694) - c.173A>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs201037241 | 59 | I>T | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.39) Somatic: No Accession: NC_000019.10:g.38893859A>G Codon: ATT/ACT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893859A>G Locations: - p.Ile59Thr (Ensembl:ENST00000443898) - c.176T>C (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs765827093 | 60 | Q>* | ExAC gnomAD | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893857G>A Codon: TCA/TTA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893857G>A Locations: - p.Gln60Ter (Ensembl:ENST00000443898) - c.178C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs765827093 | 60 | Q>E | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893857G>C Codon: CAG/GAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893857G>C Locations: - p.Gln60Glu (Ensembl:ENST00000443898) - c.178C>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs765827093 | 60 | Q>L | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303528T>A Codon: CAG/CTG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303528T>A Locations: - p.Gln60Leu (Ensembl:ENST00000635694) - c.179A>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs765827093 | 60 | Q>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303528T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303528T>C Locations: - p.Gln60Arg (Ensembl:ENST00000635694) - c.179A>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs996409143 | 61 | T>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893854T>C Codon: ACT/GCT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893854T>C Locations: - p.Thr61Ala (Ensembl:ENST00000443898) - c.181A>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs996409143 | 61 | T>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303525G>C Codon: GAC/GAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303525G>C Locations: - p.Thr61Ser (Ensembl:ENST00000635694) - c.182C>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600127241 | 62 | L>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893850A>C Codon: CTG/CGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893850A>C Locations: - p.Leu62Arg (Ensembl:ENST00000443898) - c.185T>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs200832504 | 62 | L>R | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303522A>C Codon: CTG/CGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303522A>C Locations: - p.Leu62Arg (Ensembl:ENST00000635694) - c.185T>G (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs200832504 | 62 | L>V | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893851G>C Codon: CTG/GTG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893851G>C Locations: - p.Leu62Val (Ensembl:ENST00000443898) - c.184C>G (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1600127235 | 63 | R>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893848T>C Codon: AGG/GGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893848T>C Locations: - p.Arg63Gly (Ensembl:ENST00000443898) - c.187A>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1213545144 | 64 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893844T>C Codon: GAG/GGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893844T>C Locations: - p.Glu64Gly (Ensembl:ENST00000443898) - c.191A>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs748102696 | 65 | E>* | TOPMed gnomAD | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893842C>A Codon: GGA/GTA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893842C>A Locations: - p.Glu65Ter (Ensembl:ENST00000443898) - c.193G>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1454214996 | 65 | E>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893841T>G Codon: GAG/GCG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893841T>G Locations: - p.Glu65Ala (Ensembl:ENST00000443898) - c.194A>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1454214996 | 65 | E>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303512C>G, NW_014040929.1:g.303512C>A Codon: GCC/CCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303512C>G, NW_014040929.1:g.303512C>A Locations: - p.Glu65Asp (Ensembl:ENST00000635694) - c.195G>C (Ensembl:ENST00000635694) - c.195G>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1019096585 | 65 | E>D | Variant of uncertain significance (Ensembl) | TOPMed | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893840C>A Codon: GCC/TCC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893840C>A Locations: - p.Glu65Asp (Ensembl:ENST00000443898) - c.195G>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs748102696 | 65 | E>K | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893842C>T Codon: GGA/GAA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893842C>T Locations: - p.Glu65Lys (Ensembl:ENST00000443898) - c.193G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1454214996 | 65 | E>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893841T>A Codon: GAG/GTG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893841T>A Locations: - p.Glu65Val (Ensembl:ENST00000443898) - c.194A>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs748102696 | 65 | E>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303513T>A Codon: GAG/GTG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303513T>A Locations: - p.Glu65Val (Ensembl:ENST00000635694) - c.194A>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs150974362 | 66 | P>L | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.26) Somatic: No Accession: NC_000019.10:g.38893838G>A Codon: CCG/CTG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893838G>A Locations: - p.Pro66Leu (Ensembl:ENST00000443898) - c.197C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1019096585 | 66 | P>S | Variant of uncertain significance (Ensembl) | TOPMed | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.41) Somatic: No Accession: NW_014040929.1:g.303511G>A Codon: CCG/TCG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303511G>A Locations: - p.Pro66Ser (Ensembl:ENST00000635694) - c.196C>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1019096585 | 66 | P>T | Variant of uncertain significance (Ensembl) | TOPMed | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.35) Somatic: No Accession: NW_014040929.1:g.303511G>T Codon: GCC/GAC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303511G>T Locations: - p.Pro66Thr (Ensembl:ENST00000635694) - c.196C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs926292218 | 67 | L>M | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303508G>T Codon: GCT/GAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303508G>T Locations: - p.Leu67Met (Ensembl:ENST00000635694) - c.199C>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973627408 | 67 | L>Q | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893835A>T Codon: CTG/CAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893835A>T Locations: - p.Leu67Gln (Ensembl:ENST00000443898) - c.200T>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1600127171 | 68 | V>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.05) Somatic: No Accession: NC_000019.10:g.38893832A>C Codon: GTG/GGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893832A>C Locations: - p.Val68Gly (Ensembl:ENST00000443898) - c.203T>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs199515794 | 69 | E>K | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303502C>T Codon: GAG/AAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303502C>T Locations: - p.Glu69Lys (Ensembl:ENST00000635694) - c.205G>A (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs1460165551 | 71 | Q>K | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893824G>T Codon: CAG/AAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893824G>T Locations: - p.Gln71Lys (Ensembl:ENST00000443898) - c.211C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973626882 | 71 | Q>R | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893823T>C Codon: CAG/CGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893823T>C Locations: - p.Gln71Arg (Ensembl:ENST00000443898) - c.212A>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1303453335 | 72 | T>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.17) Somatic: No Accession: NC_000019.10:g.38893820G>A Codon: ACA/ATA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893820G>A Locations: - p.Thr72Ile (Ensembl:ENST00000443898) - c.215C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs2144697771 | 73 | W>* | Ensembl | ||||
Consequence: stop gained Somatic: No Accession: NW_014040929.1:g.303198_303199insTGTCTGCTTCTCCACCAGCGGCTCCT Codon: TGG/TAGGAGCCGCTGGTGGAGAAGCAGACAGG Consequence type: stop gained Cytogenetic band: Genomic location: NW_014040929.1:g.303198_303199insTGTCTGCTTCTCCACCAGCGGCTCCT Locations: - p.Trp73Ter (Ensembl:ENST00000635694) - c.217_218insAGGAGCCGCTGGTGGAGAAGCAGACA (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973613494 | 73 | W>* | TOPMed | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893525C>T Codon: GAC/AAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893525C>T Locations: - p.Trp73Ter (Ensembl:ENST00000443898) - c.219G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1172707908 | 73 | W>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.27) Somatic: No Accession: NC_000019.10:g.38893527A>G Codon: TGG/CGG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893527A>G Locations: - p.Trp73Arg (Ensembl:ENST00000443898) - c.217T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1172707908 | 73 | W>S | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.66) Somatic: No Accession: NW_014040929.1:g.303198C>G Codon: ATG/ATC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303198C>G Locations: - p.Trp73Ser (Ensembl:ENST00000635694) - c.218G>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs765083798 | 76 | C>* | ExAC TOPMed gnomAD | ||||
Consequence: stop gained Somatic: No Accession: NC_000019.10:g.38893516G>T Codon: TGC/TGA Consequence type: stop gained Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893516G>T Locations: - p.Cys76Ter (Ensembl:ENST00000443898) - c.228C>A (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs765083798 | 77 | G>* | ExAC TOPMed gnomAD | ||||
Consequence: missense Somatic: No Accession: NW_014040929.1:g.303187C>A Codon: CGG/CTG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303187C>A Locations: - p.Gly77Ter (Ensembl:ENST00000635694) - c.229G>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs2144697716 | 77 | G>A | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893514C>G Codon: GGA/GCA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893514C>G Locations: - p.Gly77Ala (Ensembl:ENST00000443898) - c.230G>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs200012062 | 77 | G>E | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303186C>T Codon: GGA/GAA Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303186C>T Locations: - p.Gly77Glu (Ensembl:ENST00000635694) - c.230G>A (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs765083798 | 77 | G>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303187C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303187C>T Locations: - p.Gly77Arg (Ensembl:ENST00000635694) - c.229G>A (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs200012062 | 77 | G>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893515C>T Codon: CGG/CAG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893515C>T Locations: - p.Gly77Arg (Ensembl:ENST00000443898) - c.229G>A (Ensembl:ENST00000443898) Source type: large scale study | |||||||
COSV50876682 RCV000955223 rs45535036 | 79 | Y>F | Benign (Ensembl, ClinVar) | cosmic curated ClinVar 1000Genomes ESP ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.39) Somatic: Yes Population frequencies: - MAF: 0.01078 (ClinVar) Accession: NC_000019.10:g.38893508T>A Codon: TTA/TTT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893508T>A Locations: - p.Tyr79Phe (Ensembl:ENST00000443898) - c.236A>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs200819077 | 80 | S>P | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.15) Somatic: No Accession: NW_014040929.1:g.303178A>G Codon: TTC/TCC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303178A>G Locations: - p.Ser80Pro (Ensembl:ENST00000635694) - c.238T>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1600126405 | 81 | P>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.1) Somatic: No Accession: NC_000019.10:g.38893502G>A Codon: CCC/CTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893502G>A Locations: - p.Pro81Leu (Ensembl:ENST00000443898) - c.242C>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs376694959 | 83 | R>C | ESP ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893497G>A Codon: ACG/ATG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893497G>A Locations: - p.Arg83Cys (Ensembl:ENST00000443898) - c.247C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs760784746 | 83 | R>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893496C>T Codon: CGC/CAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893496C>T Locations: - p.Arg83His (Ensembl:ENST00000443898) - c.248G>A (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs376694959 | 83 | R>L | ESP ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303168C>A Codon: CGC/CTC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303168C>A Locations: - p.Arg83Leu (Ensembl:ENST00000635694) - c.248G>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs760784746 | 83 | R>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893496C>A Codon: CGC/CTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893496C>A Locations: - p.Arg83Leu (Ensembl:ENST00000443898) - c.248G>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1201810649 | 84 | S>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303166A>T Codon: CTC/CAC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303166A>T Locations: - p.Ser84Thr (Ensembl:ENST00000635694) - c.250T>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973611947 | 86 | W>* | TOPMed | ||||
Consequence: stop gained Somatic: No Accession: NC_000019.10:g.38893487C>T, NW_014040929.1:g.303158C>T Codon: TGG/TAG Consequence type: stop gained Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893487C>T, NW_014040929.1:g.303158C>T Locations: - p.Trp86Ter (Ensembl:ENST00000443898) - c.257G>A (Ensembl:ENST00000443898) - p.Trp86Ter (Ensembl:ENST00000635694) - c.258G>A (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs575999768 | 86 | W>G | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303160A>C Codon: CTG/CGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303160A>C Locations: - p.Trp86Gly (Ensembl:ENST00000635694) - c.256T>G (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs543937371 | 86 | W>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893488A>G Codon: CTG/CCG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893488A>G Locations: - p.Trp86Arg (Ensembl:ENST00000443898) - c.256T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs543937371 | 86 | W>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303159C>G Codon: TGG/TCG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303159C>G Locations: - p.Trp86Ser (Ensembl:ENST00000635694) - c.257G>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973611833 | 87 | A>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893484G>T Codon: GCA/GAA Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893484G>T Locations: - p.Ala87Glu (Ensembl:ENST00000443898) - c.260C>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
COSV107219896 rs762039728 | 90 | R>M | cosmic curated ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: Yes Accession: NC_000019.10:g.38893475C>A Codon: AAG/AAT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893475C>A Locations: - p.Arg90Met (Ensembl:ENST00000443898) - c.269G>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs762039728 | 90 | R>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303146C>A Codon: GAG/TAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303146C>A Locations: - p.Arg90Ser (Ensembl:ENST00000635694) - c.270G>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs774515802 | 91 | S>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893471G>T Codon: CGT/AGT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893471G>T Locations: - p.Ser91Arg (Ensembl:ENST00000443898) - c.273C>A (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs139357839 | 92 | V>D | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303141A>T Codon: GTC/GAC Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303141A>T Locations: - p.Val92Asp (Ensembl:ENST00000635694) - c.275T>A (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs139357839 | 92 | V>F | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893470C>A Codon: CGT/CTT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893470C>A Locations: - p.Val92Phe (Ensembl:ENST00000443898) - c.274G>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs774515802 | 92 | V>F | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303142C>A Codon: CGT/CTT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303142C>A Locations: - p.Val92Phe (Ensembl:ENST00000635694) - c.274G>T (Ensembl:ENST00000635694) Source type: large scale study | |||||||
rs774515802 | 92 | V>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303142C>T Codon: CGT/CAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303142C>T Locations: - p.Val92Ile (Ensembl:ENST00000635694) - c.274G>A (Ensembl:ENST00000635694) Source type: large scale study | |||||||
COSV105857474 rs139357839 | 92 | V>I | Variant of uncertain significance (Ensembl) | cosmic curated ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: Yes Accession: NC_000019.10:g.38893470C>T Codon: CGT/CAT Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893470C>T Locations: - p.Val92Ile (Ensembl:ENST00000443898) - c.274G>A (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1335232398 | 93 | C>F | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893466C>A Codon: TGC/TTC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893466C>A Locations: - p.Cys93Phe (Ensembl:ENST00000443898) - c.278G>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1241556108 | 93 | C>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303139A>C Codon: CTG/CGG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303139A>C Locations: - p.Cys93Gly (Ensembl:ENST00000635694) - c.277T>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs749731782 | 94 | W>* | ExAC TOPMed gnomAD | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893462C>T Codon: GAC/AAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893462C>T Locations: - p.Trp94Ter (Ensembl:ENST00000443898) - c.282G>A (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1973610873 | 95 | T>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893461T>C Codon: GAC/GGC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893461T>C Locations: - p.Thr95Ala (Ensembl:ENST00000443898) - c.283A>G (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs201677615 | 95 | T>M | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000019.10:g.38893460G>A Codon: ACG/ATG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893460G>A Locations: - p.Thr95Met (Ensembl:ENST00000443898) - c.284C>T (Ensembl:ENST00000443898) Source type: large scale study | |||||||
rs1973610873 | 95 | T>R | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NW_014040929.1:g.303132G>C Codon: GAC/GAG Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303132G>C Locations: - p.Thr95Arg (Ensembl:ENST00000635694) - c.284C>G (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs1973610463 | 96 | S>C | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: deleterious - low confidence (0.04) Somatic: No Accession: NC_000019.10:g.38893458T>A Codon: GAG/GTG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893458T>A Locations: - p.Ser96Cys (Ensembl:ENST00000443898) - c.286A>T (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1973610463 | 96 | S>I | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.08) Somatic: No Accession: NW_014040929.1:g.303129C>A Codon: GAG/GAT Consequence type: missense Cytogenetic band: Genomic location: NW_014040929.1:g.303129C>A Locations: - p.Ser96Ile (Ensembl:ENST00000635694) - c.287G>T (Ensembl:ENST00000635694) Source type: large scale study Cross-references: | |||||||
rs200888217 | 96 | S>T | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: unknown (0) - SIFT: tolerated - low confidence (0.42) Somatic: No Accession: NC_000019.10:g.38893457C>G Codon: GAG/GAC Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893457C>G Locations: - p.Ser96Thr (Ensembl:ENST00000443898) - c.287G>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1403129868 | 97 | *>R | TOPMed gnomAD | ||||
Consequence: missense Somatic: No Accession: NC_000019.10:g.38893455A>G Codon: CTG/CCG Consequence type: missense Cytogenetic band: 19q13.2 Genomic location: NC_000019.10:g.38893455A>G Locations: - p.Ter97ArgextTer45 (Ensembl:ENST00000443898) - c.289T>C (Ensembl:ENST00000443898) Source type: large scale study Cross-references: | |||||||
rs1403129868 | 97 | *>S | TOPMed gnomAD | ||||
Consequence: stop lost Somatic: No Accession: NW_014040929.1:g.303126C>G Codon: TGA/TCA Consequence type: stop lost Cytogenetic band: Genomic location: NW_014040929.1:g.303126C>G Locations: - p.Ter97SerextTer45 (Ensembl:ENST00000635694) - c.290G>C (Ensembl:ENST00000635694) Source type: large scale study Cross-references: |