C9IYL4 · C9IYL4_HUMAN
- ProteinGeneral transcription factor IIE subunit 1
- GeneGTF2E1
- StatusUniProtKB unreviewed (TrEMBL)
- Organism
- Amino acids129 (go to sequence)
- Protein existenceEvidence at protein level
- Annotation score1/5
Variants
Variant ID(s) | Position(s) | Change | Description | Clinical significance | Provenance | ||
---|---|---|---|---|---|---|---|
rs1159627198 | 3 | K>E | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.185) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120770787A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770787A>G Locations: - p.Lys3Glu (Ensembl:ENST00000469772) - c.7A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs778005543 | 4 | K>N | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.183) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120770792A>C Codon: AAA/AAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770792A>C Locations: - p.Lys4Asn (Ensembl:ENST00000469772) - c.12A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs137976106 | 5 | D>N | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.606) - SIFT: tolerated (0.05) Somatic: No Accession: NC_000003.12:g.120770793G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770793G>A Locations: - p.Asp5Asn (Ensembl:ENST00000469772) - c.13G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1392212592 | 5 | D>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.901) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770794A>T Codon: GAT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770794A>T Locations: - p.Asp5Val (Ensembl:ENST00000469772) - c.14A>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1386869692 | 6 | A>P | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.945) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770796G>C Codon: GCA/CCA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770796G>C Locations: - p.Ala6Pro (Ensembl:ENST00000469772) - c.16G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1386869692 | 6 | A>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.231) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120770796G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770796G>A Locations: - p.Ala6Thr (Ensembl:ENST00000469772) - c.16G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs558138932 | 6 | A>V | 1000Genomes ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.231) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120770797C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770797C>T Locations: - p.Ala6Val (Ensembl:ENST00000469772) - c.17C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
COSV52205302 rs781417478 | 7 | R>C | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic ExAC TOPMed dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0) Somatic: No Population frequencies: - MAF: 0.00001195 (gnomAD) Accession: NC_000003.12:g.120770799C>T Codon: CGC/TGC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770799C>T Locations: - p.R7C (NCI-TCGA:ENST00000469772) - p.Arg7Cys (Ensembl:ENST00000469772) - c.19C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs781417478 | 7 | R>G | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.887) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770799C>G Codon: CGC/GGC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770799C>G Locations: - p.Arg7Gly (Ensembl:ENST00000469772) - c.19C>G (Ensembl:ENST00000469772) Source type: large scale study | |||||||
COSV52206169 COSV52206631 rs1241939211 | 7 | R>H | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | NCI-TCGA Cosmic dbSNP gnomAD | |||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.993) - SIFT: deleterious (0) Somatic: No Population frequencies: - MAF: 0.000003982 (gnomAD) Accession: NC_000003.12:g.120770800G>A Codon: CGC/CAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770800G>A Locations: - p.R7H (NCI-TCGA:ENST00000469772) - p.Arg7His (Ensembl:ENST00000469772) - c.20G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1709344890 | 8 | T>K | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.783) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770803C>A Codon: ACA/AAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770803C>A Locations: - p.Thr8Lys (Ensembl:ENST00000469772) - c.23C>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709344913 | 10 | L>* | TOPMed | ||||
Consequence: stop gained Somatic: No Accession: NC_000003.12:g.120770809T>A Codon: TTG/TAG Consequence type: stop gained Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770809T>A Locations: - p.Leu10Ter (Ensembl:ENST00000469772) - c.29T>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1231115994 | 11 | A>G | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.942) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770812C>G Codon: GCA/GGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770812C>G Locations: - p.Ala11Gly (Ensembl:ENST00000469772) - c.32C>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs763334797 | 20 | I>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.113) - SIFT: tolerated (0.15) Somatic: No Accession: NC_000003.12:g.120770838A>G Codon: ATT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770838A>G Locations: - p.Ile20Val (Ensembl:ENST00000469772) - c.58A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709345018 | 21 | Y>* | Ensembl | ||||
Consequence: stop gained Somatic: No Accession: NC_000003.12:g.120770843T>G Codon: TAT/TAG Consequence type: stop gained Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770843T>G Locations: - p.Tyr21Ter (Ensembl:ENST00000469772) - c.63T>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs768211771 | 23 | L>F | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.946) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770849G>C Codon: TTG/TTC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770849G>C Locations: - p.Leu23Phe (Ensembl:ENST00000469772) - c.69G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs761370342 | 25 | R>Q | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.308) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120770854G>A Codon: CGG/CAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770854G>A Locations: - p.Arg25Gln (Ensembl:ENST00000469772) - c.74G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs773991987 | 25 | R>W | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.995) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770853C>T Codon: CGG/TGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770853C>T Locations: - p.Arg25Trp (Ensembl:ENST00000469772) - c.73C>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1421095190 | 26 | E>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.43) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770857A>C Codon: GAG/GCG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770857A>C Locations: - p.Glu26Ala (Ensembl:ENST00000469772) - c.77A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs767075604 | 28 | E>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.653) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770862G>C Codon: GAG/CAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770862G>C Locations: - p.Glu28Gln (Ensembl:ENST00000469772) - c.82G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1384974479 | 30 | V>M | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.151) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000003.12:g.120770868G>A Codon: GTG/ATG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770868G>A Locations: - p.Val30Met (Ensembl:ENST00000469772) - c.88G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs760649397 | 33 | A>G | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.799) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120770878C>G Codon: GCC/GGC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770878C>G Locations: - p.Ala33Gly (Ensembl:ENST00000469772) - c.98C>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs749915812 | 33 | A>S | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.13) - SIFT: tolerated (0.39) Somatic: No Accession: NC_000003.12:g.120770877G>T Codon: GCC/TCC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770877G>T Locations: - p.Ala33Ser (Ensembl:ENST00000469772) - c.97G>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs760649397 | 33 | A>V | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.885) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770878C>T Codon: GCC/GTC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770878C>T Locations: - p.Ala33Val (Ensembl:ENST00000469772) - c.98C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs766265506 | 34 | Y>C | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000003.12:g.120770881A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770881A>G Locations: - p.Tyr34Cys (Ensembl:ENST00000469772) - c.101A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs949009241 | 36 | I>M | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.108) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770888A>G Codon: ATA/ATG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770888A>G Locations: - p.Ile36Met (Ensembl:ENST00000469772) - c.108A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs753599764 | 37 | L>I | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.952) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770889C>A Codon: CTT/ATT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770889C>A Locations: - p.Leu37Ile (Ensembl:ENST00000469772) - c.109C>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1040235763 | 38 | E>G | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.935) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770893A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770893A>G Locations: - p.Glu38Gly (Ensembl:ENST00000469772) - c.113A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs754744145 | 39 | P>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770895C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770895C>T Locations: - p.Pro39Ser (Ensembl:ENST00000469772) - c.115C>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs754744145 | 39 | P>T | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770895C>A Codon: CCA/ACA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770895C>A Locations: - p.Pro39Thr (Ensembl:ENST00000469772) - c.115C>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1331655466 | 40 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.854) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770899A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770899A>G Locations: - p.Glu40Gly (Ensembl:ENST00000469772) - c.119A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs543610994 | 40 | E>K | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.269) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120770898G>A Codon: GAA/AAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770898G>A Locations: - p.Glu40Lys (Ensembl:ENST00000469772) - c.118G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs904869885 | 41 | P>L | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.633) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120770902C>T Codon: CCC/CTC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770902C>T Locations: - p.Pro41Leu (Ensembl:ENST00000469772) - c.122C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1003260306 | 44 | I>M | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.947) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120770912C>G Codon: ATC/ATG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770912C>G Locations: - p.Ile44Met (Ensembl:ENST00000469772) - c.132C>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs913789045 | 45 | P>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.079) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120770914C>T Codon: CCA/CTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770914C>T Locations: - p.Pro45Leu (Ensembl:ENST00000469772) - c.134C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs2107611716 | 45 | P>S | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.054) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120770913C>T Codon: CCA/TCA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770913C>T Locations: - p.Pro45Ser (Ensembl:ENST00000469772) - c.133C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs745910011 | 48 | K>Q | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.052) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000003.12:g.120770922A>C Codon: AAA/CAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770922A>C Locations: - p.Lys48Gln (Ensembl:ENST00000469772) - c.142A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1441888198 | 49 | Q>L | TOPMed | ||||
Consequence: stop gained Somatic: No Accession: NC_000003.12:g.120770925_120770926insTCACCTGAAAC Codon: GCCCTGAAACAG/GCCCTGAAACTCACCTGAAACAG Consequence type: stop gained Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120770925_120770926insTCACCTGAAAC Locations: - p.Gln49LeufsTer3 (Ensembl:ENST00000469772) - c.145_146insTCACCTGAAAC (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1337546018 | 52 | D>N | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.073) - SIFT: tolerated (0.1) Somatic: No Accession: NC_000003.12:g.120776427G>A Codon: GAC/AAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776427G>A Locations: - p.Asp52Asn (Ensembl:ENST00000469772) - c.154G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1185237903 | 54 | A>E | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.39) Somatic: No Accession: NC_000003.12:g.120776434C>A Codon: GCA/GAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776434C>A Locations: - p.Ala54Glu (Ensembl:ENST00000469772) - c.161C>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1185237903 | 54 | A>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: tolerated (0.18) Somatic: No Accession: NC_000003.12:g.120776434C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776434C>T Locations: - p.Ala54Val (Ensembl:ENST00000469772) - c.161C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1307779375 | 57 | T>A | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000003.12:g.120776442A>G Codon: ACT/GCT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776442A>G Locations: - p.Thr57Ala (Ensembl:ENST00000469772) - c.169A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709400603 | 57 | T>I | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000003.12:g.120776443C>T Codon: ACT/ATT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776443C>T Locations: - p.Thr57Ile (Ensembl:ENST00000469772) - c.170C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709400631 | 58 | A>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated (0.47) Somatic: No Accession: NC_000003.12:g.120776446C>T Codon: GCT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776446C>T Locations: - p.Ala58Val (Ensembl:ENST00000469772) - c.173C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1217273210 | 61 | A>T | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.017) - SIFT: tolerated (0.22) Somatic: No Accession: NC_000003.12:g.120776454G>A Codon: GCT/ACT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776454G>A Locations: - p.Ala61Thr (Ensembl:ENST00000469772) - c.181G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs146371540 | 61 | A>V | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.017) - SIFT: tolerated (0.25) Somatic: No Accession: NC_000003.12:g.120776455C>T Codon: GCT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776455C>T Locations: - p.Ala61Val (Ensembl:ENST00000469772) - c.182C>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs151252302 | 64 | A>V | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.15) Somatic: No Accession: NC_000003.12:g.120776464C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776464C>T Locations: - p.Ala64Val (Ensembl:ENST00000469772) - c.191C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs779378101 | 65 | G>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.12) Somatic: No Accession: NC_000003.12:g.120776467G>T Codon: GGT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776467G>T Locations: - p.Gly65Val (Ensembl:ENST00000469772) - c.194G>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1709401194 | 67 | H>Q | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.48) Somatic: No Accession: NC_000003.12:g.120776474C>G Codon: CAC/CAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776474C>G Locations: - p.His67Gln (Ensembl:ENST00000469772) - c.201C>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709401171 | 67 | H>Y | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.014) - SIFT: tolerated (0.71) Somatic: No Accession: NC_000003.12:g.120776472C>T Codon: CAC/TAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776472C>T Locations: - p.His67Tyr (Ensembl:ENST00000469772) - c.199C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs144386700 | 69 | R>Q | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.45) Somatic: No Accession: NC_000003.12:g.120776479G>A Codon: CGG/CAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776479G>A Locations: - p.Arg69Gln (Ensembl:ENST00000469772) - c.206G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs771735336 | 69 | R>W | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.583) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120776478C>T Codon: CGG/TGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776478C>T Locations: - p.Arg69Trp (Ensembl:ENST00000469772) - c.205C>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1452824348 | 71 | A>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.015) - SIFT: tolerated (0.2) Somatic: No Accession: NC_000003.12:g.120776484G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776484G>A Locations: - p.Ala71Thr (Ensembl:ENST00000469772) - c.211G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs954565746 | 71 | A>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.001) - SIFT: tolerated (0.22) Somatic: No Accession: NC_000003.12:g.120776485C>T Codon: GCA/GTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776485C>T Locations: - p.Ala71Val (Ensembl:ENST00000469772) - c.212C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs775989852 | 72 | W>R | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.906) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120776487T>C, NC_000003.12:g.120776487T>A Codon: TGG/CGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776487T>C, NC_000003.12:g.120776487T>A Locations: - p.Trp72Arg (Ensembl:ENST00000469772) - c.214T>C (Ensembl:ENST00000469772) - c.214T>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1424957152 | 74 | T>A | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.21) Somatic: No Accession: NC_000003.12:g.120776493A>G Codon: ACC/GCC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776493A>G Locations: - p.Thr74Ala (Ensembl:ENST00000469772) - c.220A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1282698056 | 74 | T>I | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.038) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000003.12:g.120776494C>T Codon: ACC/ATC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776494C>T Locations: - p.Thr74Ile (Ensembl:ENST00000469772) - c.221C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709401520 | 76 | G>C | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.302) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120776499G>T Codon: GGT/TGT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776499G>T Locations: - p.Gly76Cys (Ensembl:ENST00000469772) - c.226G>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs548542812 | 76 | G>D | 1000Genomes | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.09) Somatic: No Accession: NC_000003.12:g.120776500G>A Codon: GGT/GAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776500G>A Locations: - p.Gly76Asp (Ensembl:ENST00000469772) - c.227G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs116139067 | 78 | S>F | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.439) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776506C>T Codon: TCC/TTC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776506C>T Locations: - p.Ser78Phe (Ensembl:ENST00000469772) - c.233C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs775386160 | 79 | Y>C | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.322) - SIFT: tolerated (0.05) Somatic: No Accession: NC_000003.12:g.120776509A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776509A>G Locations: - p.Tyr79Cys (Ensembl:ENST00000469772) - c.236A>G (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1214094530 | 81 | D>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000003.12:g.120776515A>G Codon: GAC/GGC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776515A>G Locations: - p.Asp81Gly (Ensembl:ENST00000469772) - c.242A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs762784392 | 82 | L>F | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000003.12:g.120776519A>T Codon: TTA/TTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776519A>T Locations: - p.Leu82Phe (Ensembl:ENST00000469772) - c.246A>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs767861376 | 83 | Y>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.341) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776520T>C Codon: TAC/CAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776520T>C Locations: - p.Tyr83His (Ensembl:ENST00000469772) - c.247T>C (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1480637916 | 84 | T>P | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.173) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120776523A>C Codon: ACT/CCT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776523A>C Locations: - p.Thr84Pro (Ensembl:ENST00000469772) - c.250A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs756397594 | 85 | Q>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.513) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776528G>T Codon: CAG/CAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776528G>T Locations: - p.Gln85His (Ensembl:ENST00000469772) - c.255G>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs750603959 | 85 | Q>P | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.031) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776527A>C Codon: CAG/CCG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776527A>C Locations: - p.Gln85Pro (Ensembl:ENST00000469772) - c.254A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs753832573 | 87 | V>A | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776533T>C Codon: GTT/GCT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776533T>C Locations: - p.Val87Ala (Ensembl:ENST00000469772) - c.260T>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs373430197 | 87 | V>I | ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000003.12:g.120776532G>A Codon: GTT/ATT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776532G>A Locations: - p.Val87Ile (Ensembl:ENST00000469772) - c.259G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs755544975 | 90 | N>S | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.77) Somatic: No Accession: NC_000003.12:g.120776542A>G Codon: AAC/AGC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776542A>G Locations: - p.Asn90Ser (Ensembl:ENST00000469772) - c.269A>G (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1156611409 | 91 | M>I | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.001) - SIFT: tolerated (0.11) Somatic: No Accession: NC_000003.12:g.120776546G>C Codon: ATG/ATC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776546G>C Locations: - p.Met91Ile (Ensembl:ENST00000469772) - c.273G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs779242462 | 91 | M>L | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.19) Somatic: No Accession: NC_000003.12:g.120776544A>T Codon: ATG/TTG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776544A>T Locations: - p.Met91Leu (Ensembl:ENST00000469772) - c.271A>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs779242462 | 91 | M>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (1) Somatic: No Accession: NC_000003.12:g.120776544A>G Codon: ATG/GTG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776544A>G Locations: - p.Met91Val (Ensembl:ENST00000469772) - c.271A>G (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs748526228 | 92 | D>H | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.243) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000003.12:g.120776547G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776547G>C Locations: - p.Asp92His (Ensembl:ENST00000469772) - c.274G>C (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs748526228 | 92 | D>N | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.009) - SIFT: tolerated (0.14) Somatic: No Accession: NC_000003.12:g.120776547G>A Codon: GAT/AAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776547G>A Locations: - p.Asp92Asn (Ensembl:ENST00000469772) - c.274G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1709402328 | 94 | Q>E | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.42) Somatic: No Accession: NC_000003.12:g.120776553C>G Codon: CAA/GAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776553C>G Locations: - p.Gln94Glu (Ensembl:ENST00000469772) - c.280C>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709402357 | 94 | Q>L | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.042) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000003.12:g.120776554A>T Codon: CAA/CTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776554A>T Locations: - p.Gln94Leu (Ensembl:ENST00000469772) - c.281A>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1302502157 | 95 | E>D | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.38) Somatic: No Accession: NC_000003.12:g.120776558A>C, NC_000003.12:g.120776558A>T Codon: GAA/GAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776558A>C, NC_000003.12:g.120776558A>T Locations: - p.Glu95Asp (Ensembl:ENST00000469772) - c.285A>C (Ensembl:ENST00000469772) - c.285A>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs758695578 | 95 | E>V | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.031) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776557A>T Codon: GAA/GTA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776557A>T Locations: - p.Glu95Val (Ensembl:ENST00000469772) - c.284A>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1363735375 | 96 | D>H | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.007) - SIFT: tolerated (0.07) Somatic: No Accession: NC_000003.12:g.120776559G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776559G>C Locations: - p.Asp96His (Ensembl:ENST00000469772) - c.286G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709402501 | 96 | D>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.001) - SIFT: tolerated (0.24) Somatic: No Accession: NC_000003.12:g.120776560A>T Codon: GAT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776560A>T Locations: - p.Asp96Val (Ensembl:ENST00000469772) - c.287A>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1052031280 | 100 | A>T | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.29) Somatic: No Accession: NC_000003.12:g.120776571G>A Codon: GCC/ACC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776571G>A Locations: - p.Ala100Thr (Ensembl:ENST00000469772) - c.298G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1222340354 | 103 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.022) - SIFT: tolerated (0.06) Somatic: No Accession: NC_000003.12:g.120776581A>G Codon: GAA/GGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776581A>G Locations: - p.Glu103Gly (Ensembl:ENST00000469772) - c.308A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs916591904 | 105 | K>T | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.021) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120776587A>C Codon: AAA/ACA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776587A>C Locations: - p.Lys105Thr (Ensembl:ENST00000469772) - c.314A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs770466409 | 106 | S>T | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.26) Somatic: No Accession: NC_000003.12:g.120776589T>A Codon: TCT/ACT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776589T>A Locations: - p.Ser106Thr (Ensembl:ENST00000469772) - c.316T>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709402748 | 107 | A>V | TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.001) - SIFT: tolerated (0.27) Somatic: No Accession: NC_000003.12:g.120776593C>T Codon: GCC/GTC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776593C>T Locations: - p.Ala107Val (Ensembl:ENST00000469772) - c.320C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs2107613429 | 108 | K>R | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.082) - SIFT: tolerated (0.13) Somatic: No Accession: NC_000003.12:g.120776596A>G Codon: AAA/AGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776596A>G Locations: - p.Lys108Arg (Ensembl:ENST00000469772) - c.323A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs745328936 | 109 | E>D | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.066) - SIFT: tolerated (0.08) Somatic: No Accession: NC_000003.12:g.120776600G>C Codon: GAG/GAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776600G>C Locations: - p.Glu109Asp (Ensembl:ENST00000469772) - c.327G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1290248091 | 109 | E>G | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.521) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120776599A>G Codon: GAG/GGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776599A>G Locations: - p.Glu109Gly (Ensembl:ENST00000469772) - c.326A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs200335600 | 109 | E>K | Variant of uncertain significance (Ensembl) | ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.039) - SIFT: tolerated (0.19) Somatic: No Accession: NC_000003.12:g.120776598G>A Codon: GAG/AAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776598G>A Locations: - p.Glu109Lys (Ensembl:ENST00000469772) - c.325G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1709402906 | 111 | P>L | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (1) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120776605C>T Codon: CCT/CTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776605C>T Locations: - p.Pro111Leu (Ensembl:ENST00000469772) - c.332C>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1464776557 | 112 | I>V | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.003) - SIFT: tolerated (0.47) Somatic: No Accession: NC_000003.12:g.120776607A>G Codon: ATT/GTT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776607A>G Locations: - p.Ile112Val (Ensembl:ENST00000469772) - c.334A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1709403017 | 115 | R>G | TOPMed | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.112) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120776616A>G Codon: AGA/GGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776616A>G Locations: - p.Arg115Gly (Ensembl:ENST00000469772) - c.343A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1223139087 | 115 | R>S | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: tolerated (1) Somatic: No Accession: NC_000003.12:g.120776618A>T Codon: AGA/AGT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776618A>T Locations: - p.Arg115Ser (Ensembl:ENST00000469772) - c.345A>T (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs943697787 | 116 | E>D | gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.013) - SIFT: deleterious (0.02) Somatic: No Accession: NC_000003.12:g.120776621A>C Codon: GAA/GAC Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776621A>C Locations: - p.Glu116Asp (Ensembl:ENST00000469772) - c.348A>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs769790121 | 118 | T>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: probably damaging (0.998) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776625A>C Codon: ACT/CCT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776625A>C Locations: - p.Thr118Pro (Ensembl:ENST00000469772) - c.352A>C (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs775228983 | 120 | Q>P | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.001) - SIFT: deleterious (0.03) Somatic: No Accession: NC_000003.12:g.120776632A>C Codon: CAA/CCA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776632A>C Locations: - p.Gln120Pro (Ensembl:ENST00000469772) - c.359A>C (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs775228983 | 120 | Q>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.009) - SIFT: deleterious (0.04) Somatic: No Accession: NC_000003.12:g.120776632A>G Codon: CAA/CGA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776632A>G Locations: - p.Gln120Arg (Ensembl:ENST00000469772) - c.359A>G (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs1709403323 | 121 | G>E | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.22) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000003.12:g.120776635G>A Codon: GGG/GAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776635G>A Locations: - p.Gly121Glu (Ensembl:ENST00000469772) - c.362G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs762843047 | 121 | G>R | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.86) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120776634G>C Codon: GGG/CGG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776634G>C Locations: - p.Gly121Arg (Ensembl:ENST00000469772) - c.361G>C (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs199901409 | 122 | A>S | Variant of uncertain significance (Ensembl) | ESP ExAC TOPMed gnomAD | |||
Consequence: missense Predictions: - PolyPhen: benign (0.08) - SIFT: deleterious (0.05) Somatic: No Accession: NC_000003.12:g.120776637G>T Codon: GCA/TCA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776637G>T Locations: - p.Ala122Ser (Ensembl:ENST00000469772) - c.364G>T (Ensembl:ENST00000469772) Source type: large scale study | |||||||
COSV52204261 rs199901409 | 122 | A>T | Variant assessed as Somatic; MODERATE impact. (NCI-TCGA) | Variant of uncertain significance (Ensembl) | NCI-TCGA Cosmic ESP ExAC TOPMed gnomAD | ||
Consequence: missense Predictions: - PolyPhen: benign (0.08) - SIFT: deleterious (0.03) Somatic: Yes Accession: NC_000003.12:g.120776637G>A Codon: GCA/ACA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776637G>A Locations: - p.A122T (NCI-TCGA:ENST00000469772) - p.Ala122Thr (Ensembl:ENST00000469772) - c.364G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs1308394177 | 123 | Y>C | Ensembl | ||||
Consequence: missense Predictions: - PolyPhen: possibly damaging (0.608) - SIFT: deleterious (0.01) Somatic: No Accession: NC_000003.12:g.120776641A>G Codon: TAT/TGT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776641A>G Locations: - p.Tyr123Cys (Ensembl:ENST00000469772) - c.368A>G (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs142264455 | 124 | G>D | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated (0.6) Somatic: No Accession: NC_000003.12:g.120776644G>A Codon: GGT/GAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776644G>A Locations: - p.Gly124Asp (Ensembl:ENST00000469772) - c.371G>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs761021046 | 127 | D>H | ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.121) - SIFT: deleterious (0) Somatic: No Accession: NC_000003.12:g.120776652G>C Codon: GAT/CAT Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776652G>C Locations: - p.Asp127His (Ensembl:ENST00000469772) - c.379G>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs753977553 | 128 | M>I | ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: tolerated - low confidence (0.66) Somatic: No Accession: NC_000003.12:g.120776657G>A Codon: ATG/ATA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776657G>A Locations: - p.Met128Ile (Ensembl:ENST00000469772) - c.384G>A (Ensembl:ENST00000469772) Source type: large scale study | |||||||
rs115126115 | 128 | M>K | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: deleterious - low confidence (0.01) Somatic: No Accession: NC_000003.12:g.120776656T>A Codon: ATG/AAG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776656T>A Locations: - p.Met128Lys (Ensembl:ENST00000469772) - c.383T>A (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs115126115 | 128 | M>T | 1000Genomes ESP ExAC TOPMed gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0) - SIFT: deleterious - low confidence (0.02) Somatic: No Accession: NC_000003.12:g.120776656T>C Codon: ATG/ACG Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776656T>C Locations: - p.Met128Thr (Ensembl:ENST00000469772) - c.383T>C (Ensembl:ENST00000469772) Source type: large scale study Cross-references: | |||||||
rs184371098 | 129 | K>E | 1000Genomes ExAC gnomAD | ||||
Consequence: missense Predictions: - PolyPhen: benign (0.025) - SIFT: deleterious - low confidence (0) Somatic: No Accession: NC_000003.12:g.120776658A>G Codon: AAA/GAA Consequence type: missense Cytogenetic band: 3q13.33 Genomic location: NC_000003.12:g.120776658A>G Locations: - p.Lys129Glu (Ensembl:ENST00000469772) - c.385A>G (Ensembl:ENST00000469772) Source type: large scale study |